search for




 

Psoraleae Semen Ethanol Extract Inhibits RANKL-Induced Osteoclast Differentiation and Osteoclast Specific Genes Expression
보골지 추출물이 파골세포 분화 및 골흡수 관련 유전자 발현에 미치는 영향
Korean J Acupunct 2021;38:140-150
Published online September 27, 2021;  https://doi.org/10.14406/acu.2021.016
© 2021 Society for Meridian and Acupoint.

Gwang-hyun Ryu , Eom Ji Kim , Minsun Kim , Jae-Hyun Kim , Yujin Lee , Dae-hwan Jin , Youngjoo Sohn , Hyuk-Sang Jung
류광현ㆍ김엄지ㆍ김민선ㆍ김재현ㆍ이유진ㆍ진대환ㆍ손영주ㆍ정혁상

Department of Anatomy, College of Korean Medicine, Kyung Hee University
경희대학교 한의과대학 해부학교실
Correspondence to: Hyuk-Sang Jung
Department of Anatomy, College of Korean Medicine, Kyung Hee University, 26 Kyungheedae-ro, Dondaemun-gu, Seoul 02447, Korea
Tel: +82-2-961-9449, Fax: +82-2-961-9449, E-mail: jsh@khu.ac.kr
This research was supported by a grant of the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare, Republic of Korea (grant number: HF21C0092).
Received August 10, 2021; Revised September 1, 2021; Accepted September 13, 2021.
This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Objectives : The increase of osteoclasts could cause osteoporosis and bone-related diseases. Also, the inhibition of osteoclast differentiation is important in treating bone-related diseases. Traditionally, Psoraleae Semen has been used for geriatric diseases, aging and musculoskeletal diseases. The purpose of this study is to investigate the effect of Psoraleae Semen ethanol extract (PS) on osteoclast differentiation and its function.
Methods : To confirm the effect of PS on osteoclastogenesis and bone resorption activity, various levels of concentrations of PS (5, 10, 20 and 40 μg/ml) were tested on RAW 264.7 cells cultured with RANKL. We measured tartarate-resistant acid phosphatase (TRAP)-positive cells, TRAP activity, pit formation and F-actin ring formation. The expressions of nuclear factor of activated T-cells (NFATc1) and c-Fos were confirmed through western blot and reverse transcription- polymerase chain reaction (RT-PCR). Also, the expression of bone resorption and fusion-related genes in osteoclast was confirmed by RT-PCR.
Results : PS decreased the number of TRAP-positive cells and the TRAP activity. In addition, PS significantly inhibited the formation of pit and F-actin ring. Furthermore, PS decreased the expression of osteoclast related genes.
Conclusions : PS inhibits osteoclast differentiation and bone resorption ability through inhibition of the expression of osteoclastrelated genes. This indicates that PS may be a potential therapeutic agent to osteoporosis by suppressing osteoclastogenesis.
Keywords: Psoraleae Semen, osteoclast, RANKL, NFATc1, c-Fos
서 론

골다공증은 골량의 감소와 미세구조의 변화로 뼈의 강도가 약해져 골절이 일어나기 쉬운 상태가 되는 전신적인 골격계 질환이다1). 골다공증은 호르몬 분비 등의 변화로 파골세포 기능이 과도하게 증가하여 골 손실이 증가하거나, 약물 등에 의해 조골세포 기능이 저해되어 뼈 생성이 억제되어 발생 한다2). 또한 파골세포(osteoclast)가 오래된 골을 흡수하고 조골세포(osteoblast)가 새로운 골을 꾸준하게 생산함으로써 뼈의 유지가 조절되며, 파골세포와 조골세포 사이의 불균형으로 인해 골 관련 질환이 발생하게 된다3). 특히, 파골세포는 골의 재형성에 중요한 역할을 하며, 파골세포의 활성 증가로 인한 과도한 골 흡수는 골다공증, 류머티즘성 관절염, 치주염 같은 골 용해성 질환을 유발 한다4,5). 따라서 파골세포의 분화를 억제하는 것은 골 관련 질환을 치료 및 예방하는 중요한 목표가 될 수 있다.

파골세포는 파골세포 전구체에서 파생된 단핵구/대식세포 계통의 융합 및 분화에 의해 생성되며, 이는 receptor activator of nuclear factor (NF)-κB (RANK) ligand (RANKL)와 같은 cytokine에 의해 유도 된다6). RANKL은 파골전구세포에 존재하는 RANK와 결합하여 tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6)을 유도한다7). 유도된 TRAF6는 nuclear factor of activated T-cells (NFATc1) 및 c-Fos와 같은 파골세포 전자인자들을 활성화 시키며, NFATc1과 c-Fos는 파골세포 형성에서 중요한 역할을 하는 전사 인자이다8). 특히, NFATc1은 tartrate-resistant acid phosphatase (TRAP), cathepsin K (CTK), matrix metallopeptidase-9 (MMP-9) 그리고 osteoclast-associated receptor (OSCAR), atpase H+ transporting v0 subunit d2 (ATP6v0d2) 및 dendritic cell-specific transmembrane protein (DC-STAMP)와 같은 파골세포 분화 관련 유전자를 조절한다9,10).

서양의학에서는 골다공증 치료에 대부분 골 흡수 억제제를 사용하고 있으며, 대표적으로 사용되고 있는 골 흡수 억제제는 비스포스포네이트(bisphosphonate)이다11). 그러나 비스포스포네이트 복용에 대한 부작용에 대한 문제점들이 지적되고 있으며, 대표적인 부작용은 위장관계 부작용으로 약제가 직접 식도 점막을 자극하고 위산의 식도로의 역류를 조장하여 식도궤양 등을 유발하여 속쓰림, 오심, 구토 등이 발생 할 수 있다12). 이러한 부작용과 단점을 보완하고 안전성을 지닌 치료제가 필요한 상황이며, 그동안 한의학계에서의 많은 한약물 연구가 진행되었다.

한의학적으로 腎陰虛나 腎陽虛이 골다공증의 주요 원인으로, 骨痿나 骨痺에 속하여 滋陰强骨하거나 溫補腎陽으로 치료한다13). 한의학에서 腎氣와 골다공증 등의 근골격계 이상은 腎虛 매우 밀접한 관련이 있다고 여겨지며14), 따라서 주로 腎氣를 補해줄 수 있는 補腎의 약물을 사용한다. 보골지(補骨脂, Psoraleae Semen)는 콩과(Leguminosae)에 속한 덩굴성 본초인 보골지(Psoralea corylifolia Linné)의 성숙한 과실로서, 性은 溫하고 味는 辛苦하며 溫腎助陽, 納氣 그리고 止瀉의 효능이 있어서 陽痿遺精, 遺尿, 腰膝冷痛 그리고 五更泄瀉 등의 증상을 완화 하는데 사용되어 왔다15). 이전 연구에 따르면, 보골지는 溫腎助陽을 이용한 남성 생식세포 GC-1 및 불임증(陽痿)에 미치는 영향16) 및 항산화 작용17,18)에 대한 효과가 보고되었다. 이에 저자는 보골지가 腎陽虛로 인한 陽痿와 腎氣虛로 인한 노인질환 치료 가능성이 있음을 확인하여, 補陽에 효과적인 보골지가 골다공증 증상을 개선 시킬 수 있는지 알아보고자 연구를 수행하였다. 또한, 난소적출로 유발한 골다공증 동물 모델에서 보골지의 예방 및 치료 효과가 보고되었다19). 하지만, 보골지 에탄올 추출물의 RANKL로 유도된 파골세포 주요 기전(c-Fos/NFATc1)의 발현이 미치는 영향은 밝혀지지 않았다. 이에 본 연구는 RANKL로 유도된 NFATc1/c-Fos 기전에 대한 보골지 에탄올 추출물의 억제 효과를 규명하였고, 이 기전으로 제어되는 CTK, MMP-9, CA2, OSCAR, ATP6v0d2 그리고 DC-STAMP와 같은 파골세포 융합 및 골 흡수 인자의 발현을 분석하였고, 이에 유의한 결과를 얻어 보고하는 바이다.

재료 및 방법

1. 시약

RANKL은 Peprotech (London, UK)에서 구매하였다. 세포 배지인 Dulbecco’s modified eagle medium (DMEM)과 dulbecco’s phosphate-buffered saline (DPBS)은 Welgene (Daejeon, Korea)에서 구매하였다. 파골세포 분화에 사용되는 다른 배지인 Minimum Essential Medium alpha (alpha-MEM) 그리고 penicillin/streptomycin (P/S)은 Gibco (Gaithersburg, MD, USA)에서 구매하였다. Fetal bovine serum (FBS)는 Atlas Biologicals (Fort Collins, USA)에서 구매하였고, Cell Counting Kit-8 (CCK-8) Dojindo (Kumamoto, Japan)에서 구매하였다. TRAP staining kit, bicinchoninic acid (BCA) solution, protease inhibitor cocktail, phosphatase inhibitor cocktail 그리고 4’,6-diamidino-2-phenylindole (DAPI)와 dimethyl sulfoxide (DMSO)는 Sigma- Aldrich (Saint Louis, MI, USA)에서 구매하였다. Acti-stainTM 488 Fluorescent Phalloidin은 Cytoskeleton (Denver, CO, USA)제품을 사용하였다. Osteo assay surface plate는 Corning Incorporated (New York, NY, USA)에서 구매하였다. Primary antibody로 β-actin 그리고 c-Fos은 Santa Cruz Biotechnology (Santa Cruz, CA, USA)에서 구매하였고, anti-nuclear factor of activated T cells-c1 (NFATc1)은 BD Pharmingen (San Diego, USA)을 사용하였다. Secondry antibody로 peroxidase IgG는 Jackson Immuno-Research (West Grove, USA)에서 구매하였다. Superscript II reverse transcriptase kit는 Invitrogen (Carlsbad, CA, USA)의 제품을 사용하였다. 그리고 primer는 Genotech (Deajoen, Korea)에서 구입하였고 Taq polymerase는 Kapa Biosystems (Woburn, MA, USA)에서 구매하였다.

2. 보골지 에탄올 추출물 제조방법

연구에 사용된 보골지(Psoraleae Semen)는 중국에서 채취되었으며 옴니허브(Seoul, Korea)에서 구매하였다. 둥근 플라스크에 보골지 100 g과 30% 에탄올 1000 ml을 넣고 3주간 침지 추출하였다. 추출이 진행될 때 격일로 1시간 동안 초음파 분쇄기(sonicator)를 이용해 초음파 분쇄를 진행했다. 추출액은 여과지(Whatman no.3, Maidstone, UK)로 여과하였다. 이후, 감압농축을 한 후 동결건조 하여 보골지 에탄올 추출물(Psoraleae Semen Ethanol, 이하 PS) 3 g을 얻었다(수득율 3%). 시료는 실험 전까지 −20℃에 보관했다. 세포 실험에는 DMSO에 용해한 뒤, pore size 0.22 μm 필터를 이용하여 여과하여 사용하였다. 배양액 내 DMSO의 양은 전체 양에 1% 이상을 초과하지 않았다.

3. RAW 264.7 세포 배양

마우스 대식 세포주인 RAW 264.7 세포는 한국 세포주 은행(Seoul, Korea)에서 구매했다. RAW 264.7 세포 배양은 10% FBS와 1% penicillin/streptomycin (P/S)가 포함된 DMEM을 사용했다. 세포는 37℃에서 95% 습도와 5% CO2가 유지되는 incubator (Sanyo, Tokyo, Japan)에서 배양하여 실험에 사용하였다.

4. 세포 독성측정

PS의 RAW 264.7 세포 내 독성은 CCK-8 assay로 측정하였다. RAW 264.7 세포를 96-well plate에 5×103 cells/well의 밀도로 분주하고 24시간 동안 안정화 시켰다. 그 후 FBS가 포함되지 않은 DMEM 배지에 PS (5, 10, 20 그리고 40 μg/ml)을 처리하여 1일 동안 배양하였다. 이후 각 well 당 10 μl의 CCK-8 solution을 처리하고 37℃에 2시간 동안 배양하였다. 이후, enzyme-linked immunosorbent assay (ELISA) reader (Molecular Molecular Devices, CA, USA)을 사용하여 흡광도 450 nm에서 측정하였다. 세포 생존율은 아무것도 처리하지 않은 대조군(negative control group)에 대한 백분율로 표시하였다. 통계처리 후, 대조군 대비 PS (5, 10, 20 그리고 40 μg/ml) 군의 세포 생존율이 90%로 이하일 때 세포 독성이 있다고 판단하였다.

5. TRAP 염색 및 활성도 측정

PS가 파골세포 분화에 미치는 영향을 확인하기 위해, TRAP 염색 및 TRAP 활성도를 측정했다. RAW 264.7 세포를 파골세포로 유도하기 위해 10% FBS와 1% P/S가 포함된 a-MEM 배지를 이용하였다. RAW 264.7 세포를 96-well plate에 5×103 cells/well의 밀도로 분주하고 24시간 동안 안정화시켰다. 이후 RANKL (100 ng/ml)과 PS (5, 10, 20 그리고 40 μg/ml)가 포함된 배지로 5일간 배양하였고 2일마다 동일한 배지로 교환해주었다. 파골세포 분화가 완료된 후, 10% formalin으로 10분간 고정하였다. 이후, 증류수로 세척 한 뒤 TRAP staining kit를 이용하여 염색하였다. 도립현미경 (Olmpus, Tokyo, Japan)을 이용하여 붉은색의 TRAP 양성을 보이는 세포와 핵이 3개 이상인 세포를 파골세포로 간주하여 그 수를 세었다. 분화 배지는 새로운 96-well plate에 50 μl씩 분주하고 TRAP solution (4.93 mg Pnpp+850 μl 0.5 M acetate 용액+150 ml의 tartrate 용액)을 동량으로 첨가하여 37℃에서 1시간 동안 반응시켰다. 이후 동량의 0.5 M의 NaOH를 넣어 반응을 종료 시킨 후, 흡광도 405 nm에서 ELISA reader를 이용하여 TRAP 활성도를 측정하였다.

6. Pit 형성 억제능 분석

PS가 골 흡수능에 미치는 영향을 확인하기 위해, pit formation assay를 이용해 분석했다. RAW 264.7 세포를 osteo assay surface plate에 5×103 cells/well의 밀도로 분주하고 24시간 동안 안정화 시켰다. 그 후 RANKL (100 ng/ml)과 PS (5, 10, 20 그리고 40 μg/ ml)이 포함된 배지로 5일간 배양하였다. 파골세포 분화가 종료된 후, 4% NaCIO을 처리하여 세포를 제거하고 증류수로 세척했다. 흡수된 면적은 도립현미경으로 관찰하였고, 총 Pit area 면적은 Image J software Ver. 1.46 (National Institutes of Health, Washington D.C,)을 사용하여 측정하였다.

7. F-actin ring 형광 분석

PS가 F-actin ring 구조에 미치는 영향을 확인하기 위해, Acti-stainTM 488 Fluorescent Phalloidin을 이용해 분석했다. RAW 264.7 세포를 96-well plate에 5×103 cells/well의 밀도로 분주하고 24시간 동안 안정화 시켰다. 이후 RANKL (100 ng/ml)과 PS (5, 10, 20 그리고 40 μg/ml)이 포함된 배지로 5일간 배양하였다. 5일간 배양한 성숙한 파골세포는 4% paraformaldehyde로 20분간 고정한 뒤, DPBS로 세척하였다. 세포 투과성을 높이기 위해 permeabilization buffer (0.5% Triton X-100)로 세포를 5분간 반응시키고, DPBS로 세척하였다. 이후 F-actin ring 염색을 위해 acti-stainTM 488 phalloidin을 각 well당 100 ml씩 분주하여 상온에 30분간 반응시켰다. 그리고 핵 염색을 위해 30초간 DAPI로 염색하고, 형광현미경(Invitrogen, Carlsbad, CA, USA)으로 관찰하였다.

8. Western blot 분석

PS가 파골세포 분화 전사인자의 단백질 발현에 미치는 영향을 확인하기 위해, Western blot을 이용해 분석했다. RAW 264.7 세포를 60π dish에 5×105 cells의 밀도로 분주하고 24시간 동안 안정화 시켰다. 이후 a-MEM 배지에 RANKL (100 ng/ml)과 PS (5, 10, 20 그리고 40 μg/ml)가 포함된 배지를 처리하고 24시간 동안 배양시켰다. 상층액을 제거하고 DPBS로 3회 세척하였다. Protease inhibitor와 phosphatase inhibitor 2, 3가 첨가된 radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-Cl, 150 mM NaCl, 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS)을 사용하여 세포를 용해시키고 13,200 rpm에서 20분간 원심분리 하여 상등액(total protein)을 분리하였다. 이후 단백질은 BCA solution으로 정량하였다. 동량의 단백질(30 μg)은 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)에서 전기영동 하여 분리하였고, nitrocellulose transfer membrane (Whatman Protran, Dassel, Germany)에 이동시켰다. 이후 각각의 membrane은 5% skim milk (blocking buffer)을 이용하여 1시간 동안 비특이적 반응을 제거하였다. Primary antibody (Actin, NFATc1, c-Fos)는 1% bovine serum albumin (BSA)에 1:1,000으로 희석하여 4℃에서 24시간 동안 반응시켰다. 그 후, secondary antibody (peroxidase-conjugatedanti-IgG)는 blocking buffer에 1:10,000으로 희석하여 실온에서 1시간 동안 반응시켰다. Tris buffered saline with tween 20 (TBST) 용액으로 membrane을 10분간 6번 세척 한 뒤, enhanced chemiluminescence (ECL) kit (Santa Cruz, CA, USA) 용액을 사용하여 x-ray 필름에 발현시켰으며, Image J software (Ver 1.46, National Institute of Health, Washington D.C, USA)를 사용하여 밴드를 정량하였다.

9. RT-PCR 분석

PS가 파골세포 분화 관련 유전자의 유전자 발현에 미치는 영향을 확인하기 위해, RT-PCR을 이용해 분석했다. RAW 264.7 세포를 6-well plate에 2×105 cell/well의 밀도로 분주하고 24시간 동안 안정화 시켰다. 이후 RANKL (100 ng/ml)과 PS (5, 10, 20 그리고 40 μg/ml)이 포함된 배지를 처리하여 4일 동안 배양시켰다. 배지는 동일한 배지로 2일마다 교환해주었다. 이후 배지를 제거하였다. DPBS로 3번 세척한 뒤, TRIZol을 사용하여 total RNA를 추출하였다. 이후, Nanodrop (Thermo scientific, PA, USA)을 사용하여 RNA는 2 μg로 정량하였다. 이후, Superscript II reverse transcriptase kit를 사용하여 cDNA로 합성하였다. 합성된 cDNA는 Taq polymerase로 증폭시켰다. 사용된 primer는 Table 1에 표기하였다. 증폭된 cDNA는 SYBR green으로 염색한 1.2% agarose gel에서 분리하였고, Image J software (Ver 1.46, National Institute of Health, Washington D.C, USA)를 사용하여 밴드를 정량하였다.

Primer sequence for RT-PCR analysis

Gene Sequence Accession number Annealing Cycle
NFATc1 F: TGC TCC TCC TCC TGC TGC TC
R: CGT CTT CCA CCT CCA CGT CG
NM_198429.2 58℃ 32
c-Fos F: ATG GGC TCT CCT GTC AAC AC
R: GGC TGC CAA AAT AAA CTC CA
NM_010234.3 58℃ 40
TRAP F: ACT TCC CCA GCC CTT ACT ACC G
R: TCA GCA CAT AGC CCA CAC CG
NM_007388.3 58℃ 30
RANK F: AAA CCT TGG ACC AAC TGC AC
R: ACC ATC TTC TCC TCC CCA GT
NM_009399.3 53℃ 35
CTK F: AGG CGG CTA TAT GAC CAC TG
R: CCG AGC CAA GAG AGC ATA TC
NM_007802.4 58℃ 26
MMP-9 F: CGA CTT TTG TGG TCT TCC CC
R: TGA AGG TTT GGA ATC GAC CC
NM_013599.4 58℃ 30
CA2 F: CTC TCA GGA CAA TGC AGT GCT GA
R: ATC CAG GTC ACA CAT TCC AGC A
NM_001357334.1 58℃ 32
OSCAR F: CTG CTG GTA ACG GAT CAG CTC CCC AGA
R: CCA AGG AGC CAG AAC CTT CGA AAC T
NM_001290377.1 53℃ 35
Atp6v0d2 F: ATG GGGCCTTGCAAAAGAAATCTG
R: CGA CAG CGT CAA ACA AAG GCT TGT A
NM_175406.3 58℃ 30
DC-STAMP F: TGG AAG TTC ACT TGA AAC TAC GTG
R: CTC GGT TTC CCG TCA GCC TCT CTC
NM_001289506.1 63℃ 40
GAPDH F: ACT TTG TCA AGC TCA TTT CC
R: TGC AGC GAA CTT TAT TGA TG
NM_008084.3 58℃ 30

NFATc1 : Nuclear factor of activated T-cells cytoplasmic 1, TRAP : tartrate-resistant acid phosphatase, RANK : receptor activator of nuclear factor kappa B, CTK : cathepsin K, MMP-9 : matrix metallopeptidase-9, CA2 : carbonic anhydrase 2, OSCAR : osteoclast- associated receptor, Atp6v0d2 : ATPase H+ transporting lysosomal 38 kDa V0 subunit d2, DC-STAMP : dendritic cell–specific trans-membrane protein, GAPDH : glyceraldehyde-3-phosphate dehydrogenase.



10. 통계분석

본 연구의 실험 결과는 3번 이상 반복하여 평균(mean)±표준오차(S.E.M)로 표시하였다. 각 실험군의 통계결과는 GraphPad PRISM Software (Version 5.01, Graphpad Software, Inc, San Diego, USA)을 이용하여 그래프로 나타내었다. 각 군 사이의 평균(mean)±표준오차(S.E.M)간의 유의성은 One-way ANOVA를 통해 분석하였고 Dunnett’s multiple comparison test를 이용하여 사후 검증했으며, p value가 0.05 미만일 때, 유의성이 있는 것으로 표기하였다.

결 과

1. RAW 264.7 세포 생존률에 PS가 미치는 영향

RAW 264.7 세포 생존에 PS가 미치는 영향은 CCK-8 assay을 사용하여 확인하였다. PS는 40 μg/ml 농도 이하에서 세포 독성을 보이지 않았으며, 본 연구에서는 독성을 보이지 않는 PS 5, 10, 20, 40 μg/ml 농도에서 효능을 분석하였다(Fig. 1).

Fig. 1. Effect of PS on the cell viability in RAW 264.7 cells. RAW 264.7 cells were treated with various concentrations of PS (5, 10, 20 and 40 μg/ml) for 24 h. Cell viability was determined using the CCK-8 assay. Data are expressed as the mean±SEM of three independent experiments.

2. RANKL에 의해 유도된 파골세포 형성 및 활성과 Pit 형성에 미치는 PS의 영향

PS의 파골세포 억제 효능을 TRAP 양성 파골세포의 형성 및 TRAP 활성 측정 결과, 정상군과 대비 RANKL을 처리한 대조군에서는 TRAP 양성 파골세포가 형성되었고, PS를 처리를 통해 TRAP 양성 파골세포의 형성이 억제된 것을 확인하였다(Fig. 2A, B). 또한, TRAP 활성 측정 결과, 정상군 대비 대조군에서 유의하게(p<0.01) 증가하였고, PS를 처리한 5 μg/ml (p<0.05) 농도 및 40 μg/ml (p<0.01) 농도에서 대조군 대비 TRAP 활성이 유의하게 억제되었다(Fig. 2C). PS의 골 흡수 억제능 측정 결과, 정상군과 비교하였을 때, 대조군에서 pit area가 유의하게(p<0.01) 증가하였으며, 대조군 대비 PS 20 그리고 40 μg/ml 농도에서 pit area가 유의하게(p< 0.01) 억제되었다(Fig. 2D, E).

Fig. 2. Effect of PS on RANKL-induced osteoclast differentiation and bone resorption. RAW 264.7 cells were treated with RANKL (100 ng/ml) and PS (5, 10, 20 and 40 μg/ml) for 5 days. (A) RANKL-induced osteoclasts were stained with a TRAP staining kit. Images were captured using by microscope (magnification, ×100; scale bar 200 μm). (B) The number of TRAP-positive cells were counted. (C) TRAP activity was measured by ELISA reader. (D) Images were captured using by microscope (magnification, ×200; scale bar, 100 μm). (E) The pit area was measured by Image J software. ##p<0.01 vs. the normal cells (RANKL-untreated cells) and *p<0.05 and **p<0.01 vs. the control cells (RANKL-treated cells). Data are expressed as the mean±SEM of three independent experiments.

3. Actin ring 형성에 PS가 미치는 영향

파골세포의 F-actin ring 형성 측정 결과,정상군 대비 대조군에서 F-actin ring이 형성된 것을 확인하였으며, PS 처리를 통해 F-actin ring 형성이 억제됨을 확인하였다(Fig. 3).

Fig. 3. Effect of the PS on RANKL-induced F-actin ring formation. RAW 264.7 cells were treated with RANKL (100 ng/ml) and PS (5, 10, 20 and 40 μg/ml) for 5 days. F-actin ring was observed with a fluorescence microscope (magnifi-cation, ×200; scale bar, 100 μm).

4. 파골세포 분화 전사인자의 단백질 발현에 PS가 미치는 영향

파골세포 분화 전사인자인 NFATc1 그리고 c-Fos의 단백질 발현 측정 결과, 정상군 대비 대조군에서 NFATc1의 발현이 유의하게(p<0.01) 증가되었고, 대조군 대비 PS 10, 20, 40 μg/ml 농도에서 NFATc1의 발현이 유의하게(p<0.05) 억제되었다(Fig. 4A, B). 또한, c-Fos 단백질 발현은 정상군 대비 대조군에서 유의하게(p<0.05) 증가하였고 대조군에 비해 PS 20, 40 μg/ml 농도에서 유의하게(p<0.05) 감소하였다(Fig. 4C, D).

Fig. 4. Effect of PS on the protein expression levels of NFATc1 and c-Fos. RAW 264.7 cells were treated with RANKL (100 ng/ml) and PS (5, 10, 20 and 40 μg/ml) for 24 h. (A) The protein expression of the NFATc1 was analyzed by western blot and (B) normalized by actin. (C) The protein expression of the c-Fos was analyzed by western blot and (D) normalized by actin. #p<0.05 and ##p<0.01 vs. the normal cells (RANKL-untreated cells) and *p<0.05 vs. the control cells (RANKL-treated cells). Data are expressed as the mean±SEM of three independ-ent experiments.

5. 파골세포 분화 관련 유전자 발현에 PS가 미치는 영향

파골세포 분화 관련 유전자 발현을 측정한 결과, 정상군 대비 대조군에서 NFATc1 (p<0.01), TRAP (p<0.01) 그리고 RANK (p<0.05)의 발현이 유의하게 증가되었다. NFATc1 및 RANK의 발현은 PS 10 μg/ml (p<0.05), 20 μg/ml (p<0.01), 40 μg/ml (p<0.01) 농도에서 유의하게 억제되었다. 또한, c-Fos의 발현은 정상군 대비 대조군에서 증가하였으나 유의미하지 않았고, PS 20, 40 μg/ml 농도에서 유의하게(p<0.05) 억제되었다. TRAP의 발현은 대조군 대비 PS 20, 40 μg/ml 농도에서 유의하게(p<0.01) 감소되었다(Fig. 5).

Fig. 5. Effect of PS on the expression of osteoclast differentiation-related genes. RAW 264.7 cells were treated with RANKL (100 ng/ml) and PS (5, 10, 20 and 40 μg/ml) for 4 days. (A) Expression of mRNA levels the NFATc1, c-Fos, TRAP and RANK were analyzed by RT-PCR. (B) The mRNA expression was normalized by GAPDH. #p<0.05 and ##p<0.01 vs. the normal cells (RANKL-untreated cells) and *p<0.05 and **p<0.01 vs. the control cells (RANKL-treated cells). Data are expressed as the mean±SEM of three independent experiments.

6. 파골세포의 골 흡수 및 파골세포 융합 관련 유전자 발현에 PS가 미치는 영향

골 흡수 그리고 파골세포 융합 관련 유전자 발현을 측정한 결과, 정상군 대비 대조군에서 MMP-9 (p<0.01), CA2 (p<0.01), OSCAR (p<0.05), ATP6vod2 (p<0.01) 그리고 DC-STAMP (p<0.05)의 발현이 유의하게 증가하였다. CTK의 경우, 정상군 대비 대조군에서 발현이 증가하였으나 유의미한 영향을 나타내지 않았고, PS 20, 40 μg/ml 농도에서 유의하게(p<0.05) 억제되었다. MMP-9 및 DC-STAMP의 발현은 PS 20 그리고 40 μg/ml 농도에서 유의하게(p<0.01) 감소하였다. CA2 그리고 ATP6v0d2의 경우, PS 20 μg/ml (p<0.05), 40 μg/ml (p<0.01) 농도에서 유의하게 억제되었다. 또한 OSCAR 발현은 PS 10 μg/ml (p<0.05), 20 μg/ml (p<0.01), 40 μg/ml (p<0.01) 농도에서 유의하게 감소하였다(Fig. 6).

Fig. 6. Effect of PS on the mRNA expression of bone resorption (CTK, MMP-9 and CA2) osteoclast fusion genes (OSCAR, ATP6v0d2 and DC-STAMP). RAW 264.7 cells were treated with RANKL (100 ng/ml) and PS (5, 10, 20 and 40 μg/ml) for 4 days. (A) The expression of bone resorption and osteoclast fusion genes were analyzed by RT-PCR. (B) The mRNA expression was normalized by GAPDH. #p<0.05 and ##p<0.01 vs. the normal cells (RANKL-untreated cells) and *p<0.05 and **p<0.01 vs. the control cells (RANKL-treated cells). Data are expressed as the mean±SEM of three independent experiments.
고 찰

본 연구는 補骨脂 추출물이 파골세포 분화 및 골 흡수 관련 유전자 발현에 미치는 영향을 연구하였다. 실험 결과, PS 처리는 RAW 264.7 세포에서 독성을 나타내지 않으며 TRAP 양성 파골세포의 형성, TRAP 활성도, pit area 및 F-actin ring 형성을 억제하였다. 또한 NFATc1과 c-Fos의 발현 및 파골세포의 골 흡수 및 세포 융합 관련 유전자의 발현을 유의하게 감소시켰다.

PS의 세포독성은 CCK-8 assay를 통해 측정하였고, 그 결과 실험에 사용된 모든 농도의 PS는(5, 10, 20 그리고 40 μg/ml) RAW 264.7 세포의 생존율에 영향을 주지 않음을 확인하였다. TRAP은 성숙한 파골세포에 의해 분비되며 파골세포를 식별하기 위한 화학적 표지자로서 사용 된다20). 또한 Pit area는 파골세포의 주요 기능인 골 기질의 재흡수 이후에 형성되기 때문에 파골세포의 활성 및 골 흡수와 관련이 있다21). F-actin ring의 형성은 파골세포에 의한 골 흡수 전제 조건이다22). 따라서 Pit area 및 F-actin ring의 형성은 파골세포의 골 흡수 능력을 평가할 수 있는 지표가 된다. 실험 결과, PS 처리를 통해 TRAP 양성 파골세포 수, TRAP 활성도, pit area 및 F-actin ring 형성이 억제되었고 이는 PS가 파골세포 분화 및 파골세포의 주요 기능인 골 흡수를 억제하여 파골세포 분화를 억제할 수 있음을 시사한다.

파골세포 분화는 RANKL과 RANK의 결합에 의해 촉진되며 RANK 신호 전달은 파골세포 분화관련 전사인자인 c-Fos 및 NFATc1을 유도하여 성숙한 파골세포로 분화시킨다6,23). NFATc1이 결핍된 마우스에서 파골세포 분화가 진행되지 않는 것으로 보고되었으며24), c-Fos가 결핍된 마우스는 골 화석증 표현형을 나타낸다25). 실험 결과, 대조군 대비 PS를 처리한 군에서 NFATc1 및 c-Fos의 단백질과 유전자 발현이 유의하게 억제되었다. 이러한 결과는 PS가 NFATc1/c-Fos 신호전달 경로를 통해 파골세포 분화, 형성그리고 골 흡수를 억제함을 나타낸다.

NFATc1은 파골세포의 골 재흡수 관련 유전자의 발현을 조절한다26). RANK-결핍 마우스는 파골세포 분화의 차단으로 인한 심각한 골화석증을 특징으로 한다27). 골 재흡수는 파골 세포 분화와 골 기질 분해에 의해 매개되며, 파골세포 활성으로 인한 CTK 및 MMP-9의 발현 증가는 골 기질 물질인 콜라겐을 분해하여 결과적으로 칼슘이 유리되어 골 흡수를 유발한다28). CA2는 c-Fos에 의해 파골 세포 분화 초기 단계에 발현되며, CA2는 성숙한 파골 세포에서 양성자 생성에 중요한 역할을 한다29). 본 연구 결과, 대조군 대비 PS 처리군에서 CTK, MMP-9 및 CA2의 발현이 유의하게 감소하였다. 이러한 결과는 PS가 NFATc1 발현 억제를 통해 파골세포 분화 관련 유전자의 발현을 억제시켰음을 시사한다.

PS 처리가 파골세포의 성숙 및 세포 융합 관련 유전자의 발현에 미치는 영향을 조사하였다. OSCAR는 NFATc1을 활성화 시키며 파골세포 분화에 중요한 역할을 하고, 단핵구/대식세포 계통의 면역 세포 활성 및 성숙을 조절한다30). 또한 OSCAR는 파골 세포 생성을 촉진시켜 파골 세포의 수를 증가시키는 신호를 전달하는 것으로 알려져 있다31). Atp6v0d2 그리고 DC-STAMP는 파골전구세포의 세포-세포 융합 관련 유전자이며, 세포-세포 융합은 파골세포와 같은 다핵세포의 발달에 필수적이고 융합으로 매개된 다핵세포 형성은 파골세포의 성숙에 중요하다32). 또한 Atp6v0d2는 세포 바깥의 산성화에 관여하여 골 흡수의 잠재적 기능을 가진 것으로 판단되고 있다33). DC-STAMP는 파골 세포 형성과 조골세포의 분화에 중요한 역할을 하는 것으로 알려져 있으며, 뼈의 항상성에 필수적인 역할을 한다34,35). 실험 결과, PS를 처리는 대조군에 대비 OSCAR, Atp6v0d2 그리고 DC-STAMP의 발현을 억제하였다. 이는 PS가 NFATc1 발현 억제를 통해 파골세포의 골 흡수 및 파골세포 융합관련 유전자의 발현을 억제시켰음을 시사한다.

본 연구의 한계점은 다음과 같다. I) RANKL로 자극된 c-Fos의 발현이 유전자 수준과 단백질 수준에서 차이릍 나타낸다. 단백질 수준에서의 c-Fos는 RANKL 자극을 통해 normal 세포에 비해 유의하게 증가되었지만, 유전자 수준에서는 증가되는 경향을 나타냈지만, 그 차이가 유의하지 않았다. 이러한 결과는, 각 실험의 sampling time에 차이에 의해 발생된다고 추측된다. c-Fos는 파골세포 분화 초기 인자로, RANKL 자극 초기에 상승한다. 본 실험에서 c-Fos 발현에 대한 PS의 억제능 검증 실험을 진행할 때, 단백질 발현은 1일에서 측정되었고, 유전자 발현은 4일에서 측정되었다. 따라서, 초기 발현에 영향을 주는 c-Fos는 RANKL처리 1일차에서 4일보다 상대적으로 높이 발현 될 것으로 추측된다. 이러한 가설을 확인하기 위해서, RANKL 처리 1일 후 c-Fos의 발현 및 PS의 언제능을 유전자 수준에서 검증하는 것은 유의미한 향후 연구로 사료된다. II) 골세포 분화 전사인자인 c-Fos에 PS가 미치는 영향에 대해 분석한 결과, c-Fos의 단백질 분석 결과 정상군 대비 유발군에서 발현이 유의하게 증가했다. 하지만, c-Fos의 유전자 분석 결과 정상군 대비 유발군에서 유의미하지 않았다. 하지만, 통계적으로 유발군 대비 PS 처리군의 유의한 효과를 확인했다. Western blot과 RT-PCR에서, 유발군의 통계적 유의성에 대한 실험 결과가 동일하지 않은 결과는 추가 실험이 필요한 것으로 사료된다. III) c-Fos의 경우 전사조절인자로서 신경활성지표(a marker of neuronal activation)로 많이 사용되고 있다. 본 연구결과, PS는 파골세포 전사인자와 파골세포 분화 관련인자의 발현을 아무것도 처리하지 않은 정상군의 발현과 비슷하거나 조금 더 낮게 억제했다. 이러한 결과는, 향후 PS가 RANKL로 증가된 c-Fos의 발현 뿐만 아니라 아무것도 자극되지 않은(normal cell)의 c-Fos의 발현에도 영향을 나타낼 수 있다는 것을 의미한다. 이러한 가설은 향후, 신경활성지표인 c-Fos의 영향을 받는 통각관련 질환 및 우울증 등에 PS의 가능성을 보여준다고 사료된다. 하지만, 본 연구에서 PS 단독처리군의 대한 실험은 PS 단독처리군에 대한 실험은 진행되지 못했으며, 향후 이와 관련한 추가적인 실험 PS의 세포 내 역할을 명확히 규명하는데 유의미한 연구라고 사료된다.

결 론

補骨脂 에탄올 추출물이 파골세포 분화 및 골흡수 관련 유전자 발현에 미치는 영향을 알아보기 위하여 RAW 264.7 세포를 이용한 실험을 진행하였고, 다음과 같은 결과를 얻었다.

1. 補骨脂는 RANKL로 유도된 TRAP 양성 파골세포와 TRAP 활성도를 유의하게 감소시켰고, 이는 파골세포의 분화를 억제함을 의미한다.

2. 補骨脂는 RANKL로 유도된 파골세포의 골 흡수 pit area를 유의하게 감소시켰다.

3. 補骨脂는 RANKL로 유도된 파골세포의 F-actin ring 형성을 억제하였고, 이는 골 흡수능 억제를 의미한다.

4. 補骨脂는 RANKL로 유도된 파골세포 분화 관련 인자인 NFATc1과 c-Fos 발현과골 흡수(CTK, MMP-9 그리고 CA2) 그리고 파골세포 융합(OSCAR, ATP6v0d2 그리고 DC-STAMP) 관련 유전자의 발현을 감소시켰다.

위 결과를 종합하면, 補骨脂는 파골세포 관련 유전자 발현의 억제를 통해 파골세포 분화 및 골 흡수능을 억제하였다. 이는 補骨脂로 인한 골 흡수 억제를 통해 골다공증 개선의 가능성을 보여주는 것으로, 補骨脂가 골다공증 치료제로서 임상 응용이 가능할 것이라고 사료된다. 이에 추후 補骨脂의 골다공증 치료에 대한 보다 많은 임상 연구 및 실험연구가 필요할 것으로 생각된다.

Acknowledgement

본 연구는 보건복지부의 재원으로 한국보건산업진흥원의 보건의료기술연구개발사업 지원에 의하여 이루어진 것임(과제고유번호 : HF21C0092).

Funding

This research was supported by a grant of the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare, Republic of Korea (grant number: HF21C0092).

Data availability

The authors can provide upon reasonable request.

Conflicts of interest

저자들은 아무런 이해 상충이 없음을 밝힌다.

References
  1. Lane JM, Russell L, Khan SN. OsteoporosisClinical Orthopaedics and Related Research. 2000 ; 372 : 139-50. https://doi.org/10.1097/00003086-200003000-00016.
    Pubmed CrossRef
  2. Rodan GA, Martin TJ. Therapeutic approaches to bone diseasesScience. 2000 ; 289(5484) : 1508-14. https://doi.org/10.1126/science.289.5484.1508.
    Pubmed CrossRef
  3. Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and activationNature. 2003 ; 423(6937) : 337-42. https://doi.org/10.1038/nature01658.
    Pubmed CrossRef
  4. Wagner EF, Karsenty G. Genetic control of skeletal developmentCurr Opin Genet Dev. 2001 ; 11(5) : 527-32. https://doi.org/10.1016/s0959-437x(00)00228-8.
    CrossRef
  5. Karsenty G, Wagner EF. Reaching a genetic and molecular understanding of skeletal developmentDev Cell. 2002 ; 2(4) : 389-406. https://doi.org/10.1016/s1534-5807(02)00157-0.
    CrossRef
  6. Suda T, Takahashi N, Udagawa N, Jimi E, Gillespie MT, Martin TJ. Modulaton of osteoclast differentiation and function by the new members of the tumor necrosis factor receptor and ligand familiesEndocr Rev. 1999 ; 20(3) : 345-57. https://doi.org/10.1210/edrv.20.3.0367.
    Pubmed CrossRef
  7. Nakashima T, Hayashi M, Takayanagi H. New insights into osteoclastogenic signaling mechanismsTrends Endocrinol Metab. 2012 ; 23(11) : 582-90. https://doi.org/10.1016/j.tem.2012.05.005.
    Pubmed CrossRef
  8. Huang H, Chang EJ, Ryu J, Lee ZH, Lee Y, Kim HH. Induction of c-Fos and NFATc1 during RANKL-stimulated osteoclast differentiation is mediated by the p38 signaling pathwayBiochem Biophys Res Commun. 2006 ; 351(1) : 99-105. https://doi.org/10.1016/j.bbrc.2006.10.011.
    Pubmed CrossRef
  9. Kim JH, Kim N. Regulation of NFATc1 in Osteoclast DifferentiationJ Bone Metab. 2014 ; 21(4) : 233-41. https://doi.org/10.11005/jbm.2014.21.4.233.
    Pubmed KoreaMed CrossRef
  10. Kim K, Lee SH, Kim JH, Choi Y, Kim N. NFATc1 induces osteoclast fusion via up-regulation of Atp6v0d2 and the dendritic cell-specific transmembrane protein (DC-STAMP)Mol Endocrinol. 2008 ; 22(1) : 176-85. https://doi.org/10.1210/me.2007-0237.
    Pubmed KoreaMed CrossRef
  11. Reid IR. Bisphosphonates in the treatment of osteoporosis: a review of their contribution and controversiesSkeletal Radiol. 2011 ; 40(9) : 1191-6. https://doi.org/10.1007/s00256-011-1164-9.
    Pubmed CrossRef
  12. McClung M, Harris ST, Miller PD, Bauer DC, Davison KS, Dian L, et al. Bisphosphonate therapy for osteoporosis: benefits, risks, and drug holidayAm J Med. 2013 ; 126(1) : 13-20. https://doi.org/10.1016/j.amjmed.2012.06.023.
    Pubmed CrossRef
  13. Kim JY, Song YS. East-West medical examination of osteoporosisJ Korean Med Rehabil. 1996 ; 6(1) : 293-315.
  14. Medical College of Nanjing University of Traditional Chinese Medicine. Interpretation of the Yellow Emperor's Internal Classics. Shanghai: Shanghai Science and Technology Press. 1983 : 4-5.
  15. Herbology Editorial Committee of Korean Medicine. Herbology. Younglimsa 2009 ; 607-8.
  16. Oh MS, Kim DR, Kim SY, Chang MS, Park SK. Antioxidant Effects of Psoraleae Fructus in GC-1 CellsJ Physiol Pathol Korean Med. 2005 ; 19(1) : 81-6.
  17. Jeong JC, Jang YS, Min GW. Peroxynitrite Scavenging Mechanism of Psoralea corylifoliaJ Int Korean Med. 2004 ; 25(2) : 268-76.
  18. Park YK, Kang BS. Effects of Psoraleae Semen on Antioxidation in Rat's liverKor J Herbol. 1996 ; 11(2) : 101-14.
  19. Seo BI, Kim SH. A Study on the Effects of Allii Tuberosi Semen in Ovariectomized Osteoporosis of RatsHerbal Formula Science. 1997 ; 5(1) : 179-83.
  20. Angel NZ, Walsh N, Forwood MR, Ostrowski MC, Cassady AI, Hume DA. Transgenic mice overexpressing tartrate-resistant acid phosphatase exhibit an increased rate of bone turnoverJ Bone Miner Res. 2000 ; 15(1) : 103-10. https://doi.org/10.1359/jbmr.2000.15.1.103.
    Pubmed CrossRef
  21. Charles JF, Aliprantis AO. Osteoclasts: more than 'bone eaters'Trends Mol Med. 2014 ; 20(8) : 449-59. https://doi.org/10.1016/j.molmed.2014.06.001.
    Pubmed KoreaMed CrossRef
  22. Rumpler M, Würger T, Roschger P, Zwettler E, Sturmlechner I, Altmann P, et al. Osteoclasts on Bone and Dentin In Vitro: Mechanism of Trail Formation and Comparison of Resorption BehaviorCalcif Tissue Int. 2013 ; 93(6) : 526-39. https://doi.org/10.1007/s00223-013-9786-7.
    Pubmed KoreaMed CrossRef
  23. Zhao Q, Wang X, Liu Y, He A, Jia R. NFATc1: functions in osteoclastsInt J Biochem Cell Biol. 2010 ; 42(5) : 576-9. https://doi.org/10.1016/j.biocel.2009.12.018.
    Pubmed CrossRef
  24. Winslow MM, Pan M, Starbuck M, Gallo EM, Deng L, Karsenty G, et al. Calcineurin/NFAT signaling in osteoblasts regulates bone massDev Cell. 2006 ; 10(6) : 771-82. https://doi.org/10.1016/j.devcel.2006.04.006.
    Pubmed CrossRef
  25. Arai A, Mizoguchi T, Harada S, Kobayashi Y, Nakamichi Y, Yasuda H, et al. Fos plays an essential role in the upregulation of RANK expression in osteoclast precursors within the bone microenvironmentJ Cell Sci. 2012 ; 125(Pt 12) : 2910-7. https://doi.org/10.1242/jcs.099986.
    Pubmed CrossRef
  26. Takayanagi H, Kim S, Koga T, Nishina H, Isshiki M, Yoshida H, et al. Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclastsDev Cell. 2002 ; 3(6) : 889-901. https://doi.org/10.1016/s1534-5807(02)00369-6.
    CrossRef
  27. Dougall WC, Glaccum M, Charrier K, Rohrbach K, Brasel K, De Smedt T, et al. RANK is essential for osteoclast and lymph node developmentGenes Dev. 1999 ; 13(18) : 2412-24. https://doi.org/10.1101/gad.13.18.2412.
    Pubmed KoreaMed CrossRef
  28. Pittayapruek P, Meephansan J, Prapapan O, Komine M, Ohtsuki M. Role of Matrix Metalloproteinases in Photoaging and PhotocarcinogenesisInt J Mol Sci. 2016 ; 17(6) : 868. https://doi.org/10.3390/ijms17060868.
    Pubmed KoreaMed CrossRef
  29. Lehenkari P, Hentunen TA, Laitala-Leinonen T, Tuukkanen J, Väänänen HK. Carbonic anhydrase II plays a major role in osteoclast differentiation and bone resorption by effecting the steady state intracellular pH and Ca2+Exp Cell Res. 1998 ; 242(1) : 128-37. https://doi.org/10.1006/excr.1998.4071.
    Pubmed CrossRef
  30. Nemeth K, Schoppet M, Al-Fakhri N, Helas S, Jessberger R, Hofbauer LC, et al. The role of osteoclast-associated receptor in osteoimmunologyJ Immunol. 2011 ; 186(1) : 13-8. https://doi.org/10.4049/jimmunol.1002483.
    Pubmed CrossRef
  31. Barrow AD, Raynal N, Andersen TL, Slatter DA, Bihan D, Pugh N, et al. OSCAR is a collagen receptor that costimulates osteoclastogenesis in DAP12-deficient humans and miceJ Clin Invest. 2011 ; 121(9) : 3505-16. https://doi.org/10.1172/JCI45913.
    Pubmed KoreaMed CrossRef
  32. Kodama J, Kaito T. Osteoclast Multinucleation: Review of Cur-rent LiteratureInt J Mol Sci. 2020 ; 21(16) : 5685. https://doi.org/10.3390/ijms21165685.
    Pubmed KoreaMed CrossRef
  33. Wu H, Xu G, Li YP. Atp6v0d2 is an essential component of the osteoclast-specific proton pump that mediates extracellular acidification in bone resorptionJ Bone Miner Res. 2009 ; 24(5) : 871-85. https://doi.org/10.1359/jbmr.081239.
    Pubmed KoreaMed CrossRef
  34. Chiu YH, Ritchlin CT. DC-STAMP: A Key Regulator in Osteoclast DifferentiationJ Cell Physiol. 2016 ; 231(11) : 2402-7. https://doi.org/10.1002/jcp.25389.
    Pubmed KoreaMed CrossRef
  35. Courtial N, Smink JJ, Kuvardina ON, Leutz A, Göthert JR, Lausen J. Tal1 regulates osteoclast differentiation through suppression of the master regulator of cell fusion DC-STAMPFASEB J. 2012 ; 26(2) : 523-32. https://doi.org/10.1096/fj.11-190850.
    Pubmed CrossRef


September 2021, 38 (3)
Full Text(PDF) Free


Cited By Articles
  • CrossRef (0)

Funding Information
Social Network Service
Services