search for




 

Effects of the Pharmacopuncture with MOK on Immune Regulation by Th1/Th2 Cytokines in L-Thyroxine-Induced Hyperthyroid Rats
L-thyroxine으로 유발된 갑상선기능항진증 랫트에서 MOK 약침의 Th1/Th2 사이토카인 조절에 의한 면역조절 효과
Korean J Acupunct 2018;35:91-97
Published online June 27, 2018;  https://doi.org/10.14406/acu.2018.010
© 2018 Society for Meridian and Acupoint.

Ji Hye Hwang1 , and Hyo Won Jung2
황지혜1, 정효원2

1Department of Acupuncture & Moxibustion Medicine, College of Korean Medicine, Gachon University,
2Korean Medicine R&D Center, College of Korean Medicine, Dongguk University
1가천대학교 한의과대학 침구의학과,
2동국대학교 한의과대학
Correspondence to: Hyo Won Jung Korean Medicine R&D Center, College of Korean Medicine, Dongguk University, Dongdaero 123, Gyeongju 38066, Korea Tel: +82-54-770-2367, Fax: +82-54-770-2647, E-mail: tenzing2@hanmail.net
Received April 18, 2018; Revised June 9, 2018; Accepted June 9, 2018.
This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Objectives:

This study was performed to investigate immune regulatory effects of the pharmacopuncture with MOK on hyperthyroid rats.

Methods:

The experimental hyperthyroidism was prepared by the intraperitoneal injection of L-thyroxine(LT4, 0.5 mg/kg) once daily for 2 weeks in Sprague-Dawley(SD) rats. The pharmacopuncture with MOK extract(MOK pharmacopuncture) at doses of 0.3 or 3 mg/kg was injected on acupuncture points in the thyroid glands of hyperthyroid rats once a day for 2 weeks. Propylthiouracil(PTU, 10 mg/kg) as a reference group was subcutaneously injected into the dorsal neck. We measured the levels of IFN-γ and IL-4 in the sera of rats using enzyme-linked immunosorbant assay(ELISA) and determined the expression of IFN-γ, IL-4, IL-10, and Foxp3 in spleen tissues by reverse transcriptase-polymerase chain reaction(RT-PCR).

Results:

The treatment of MOK pharmacopuncture in hyperthyroid rats significantly decreased the serum levels of Th1 cytokine, IFN-γ(p< 0.01 for MOK 0.3 mg/kg, p<0.05 for MOK 3 mg/kg, and p<0.05 for PTU) and significantly increased the levels of Th2 cytokine, IL-4(p<0.05 for MOK 0.3 mg/kg, p<0.001 for MOK 3 mg/kg, and p<0.05 for PTU) compared to control group. Also, the MOK pharmacopuncture significantly increased IL-4 expression(p<0.05 for MOK 3 mg/kg, and p<0.05 for PTU), IL-10(p<0.05 for MOK 3 mg/kg, and p<0.01 for PTU), and Foxp3(p<0.01 for MOK 0.3 mg/kg, p<0.05 for MOK 3 mg/kg and p<0.01 for PTU) in spleen tissues of hyperthyroid rats compared to control group.

Conclusions:

Our results suggest that MOK pharmacopuncture can help to ameliorate the pathological progression of hyperthyroidism by regulation of the Th1/Th2 imbalance.

Keywords: pharmacopuncture, hyperthyroidism, immune regulation, Th1/Th2 cytokines, MOK
서론

갑상선은 우리 몸의 내분비계 장기 중 가장 큰 장기로 갑상선 호르몬을 만들어 몸의 기능을 적절하게 유지하게 하는 기관이며, 갑상선 호르몬은 수분 대사를 비롯한 인체의 각 종 기초대사를 조절하고 발육을 촉진시키는 등의 역할을 한다1,2). 갑상선기능항진증(hyperthyroidism)은 다양한 유전적, 환경적 요인에 의해 갑상선 호르몬이 지속적으로 합성 및 과잉 분비되는 갑상선 기능의 항진 상태를 말하며, 혈중 갑상선 호르몬 증가로 생리학적 이상이 나타나는 갑상선중독증과 같은 의미로 사용되기도 한다3). 현재 우리나라의 갑상선기능항진증 환자는 2014년 국민건강보험 가입 기준 23 만 명으로 매우 흔한 내분비계 질환이다, 갑상선기능항진증은 식욕 증가에도 불구하고 체중 감소, 과다 활동, 신경질적이고 급한 성미, 피로, 불면증, 집중력 장애, 미세한 진전, 빈맥, 심계항진, 다한증, 열불내성, 설사 등인체 전반적인 대사항진 증상으로 환자의 삶의 질을 심각하게 저해하게 된다4). 갑상선기능항진증 치료는 방사선 요오드법, 갑상선절제술, 항갑상선제 투여요법 등 갑상선호르몬의 과도한 생산을 조절하여 정상화시키는 대증 요법이 이루어지고 있으며, 약물의 다양한 부작용과 갑상선의 영구적 기능 저하와 재발 등의 단점을 안고 있다5,6).

한의학에서 갑상선 질환은 영(癭)이라 하여 침, 뜸, 한약 등 다양한 치료방법을 사용하며, 신체 음양의 불균형으로 발생하고 원인이 되는 면역기능의 불균형을 정상화시킴으로써 증상개선과 원인치료를 동시에 할 수 있다고 본다. 현재 한약 및 침구 치료를 활용한 갑상선 질환의 한의학적 치료방법에 대한 연구가 보고되고 있으나 임상에서 활용되고 있는 약침을 활용한 침구요법에 대한 구체적 연구사례는 아직 부족하며 연구가 필요한 실정이다. 중의학에서는 갑상선 질환의 약침치료가 일반적으로 이루어지고 있지만 혈위주사에 대한 연구사례는 보고된 바 없다7). 한약 연구에서는 국내 연구자들을 중심으로 갑상선기능항진증이나 갑상선기능저하증 동물모델에서의 효능이 보고8-13)(참고문헌은 대표적인 것만 첨부)되고 있으나 아직 대사조절이나 면역기전에서의 구체적 연구는 거의 보고된 바 없다.

MOK는 자하거, 우황, 사향, 웅담을 포함한 10가지 약물로 구성된 약침액으로 현재 임상에서 갑상선기능항진증, 갑상선기능저하증, 갑상선비대증 및 갑상선종 등 다양한 갑상선 질환 치료에 활용하고 있다14). 갑상선 질환에서 MOK 약침액을 이용한 침 치료는 갑상선 부위 혈위(양측 수돌혈, ST10)를 사용하기 때문에 시술방법이 간편하고 해당부위에 직접적인 약물효과를 줄 수 있어 치료효율을 높여 줄 수 있다. 본 연구자는 선행연구에서 MOK 약침(MOK pharmacopuncture)이 갑상선기능항진증 동물모델에서 체온조절과 갑상선호르몬 분비 조절 및 항산화 효과를 통해 증상을 개선시킴을 확인하였다15). 또한 최근 갑상선기능항진증과 Th1/Th2 면역반응 불균형의 상호 연관성을 비교한 연구들이 보고된 바 있다.16,17) 따라서 본 연구에서는 MOK 약침액의 갑상선기능항진증 개선효과 연구를 바탕으로 MOK 약침액의 조절기전을 알아보기 위해 갑상선기능항진증이 유발된 랫트(rat)의 비장조직(spleen)으로부터 비장세포를 분리하여 혈액에서의 MOK 약침의 Th1/Th2 사이토카인 불균형 조절 효과를 확인하였으며 유의한 결과를 얻었기에 보고하는 바이다.

실험 방법

1. 재료

1) MOK 약침

대한면역약침학회로부터 원외탕전한 자하거, 사향, 웅담, 우황, 황금, 황백, 백두옹, 산두근, 목향, 침향의 10가지 약물로 구성된 복합약침액인 MOK를 공급받아 본 실험에 사용하였다(Table 1).

Composition of MOK pharmacopuncture

  Herbal name  Scientific nameRatio (mg/ml)
Hominis PlacentaHominis placenta2
MoschusMoschus berezovskii0.5
Fel UrsiUrsus arctos0.3
Calculus Bovis Cow bezoarBos taurus0.3
Scutellariae RadixScutellaria baicalensis10
Phellodendri CortexPhellodendron amurense10
Pulsatilla KoreanaPulsatilla koreana10
Sophorae Subprostratae RadixSophora tonkinensis10
Aucklandiae RadixAucklandia lappa5
Aquilaria agallochaAquilaria agallocha5

2) 실험동물

본 실험에 사용한 실험동물은 5주령 Sprague- Dawley(SD)계 수컷 랫드(rat, 170∼190 g)를 (주)오리엔트바이오 (경기도, 한국)로부터 공급받아 1주일 동안 순화시킨 후 갑상선기능항진증 동물모델 제작에 사용하였다. 실험기간동안 일정량의 고형사료(200 g)와 정수된 물(500 ml)을 섭취시켰으며, 명암은 12시간(Day light 08:00∼20:00) 주기로, 23±2°C의 실내온도와 50±10%의 습도를 유지하여 실험종료까지 일정한 사육조건을 유지시켰다. 모든 실험동물은 동물보호법 13조 및 동국대학교 동물실험윤리위원회 심의(No. 130387)에 따라 관리하였다.

2. 방법

1) 갑상선기능항진증 동물모델 제작

갑상선기능항진증 동물모델을 제작하기 위해 갑상선호르몬인 L-thyroxine(LT4, 0.5 mg/kg)를 매일 1회씩 4주 동안 복강 주사하였다. 정상군은 LT4 대신 같은 용량의 생리식염수를 복강에 주사하여 동일한 조건을 유지하였다. MOK 약침액의 투여는 2주간 LT4를 주사한 후 3주 째 부터 4주 실험종료 시점까지 2주 동안 갑상선 부위에 0.3 mg/kg과 3 mg/kg을 피하 주사하였다(Fig. 1). 양성 대조약물로 항갑상선제인 propylthiouracil(PTU, 10 mg/kg)를 경혈자침의 효과를 배제하기 위해서 등(dorsal) 부위 경부에 피하주사하였으며, 정상군과 갑상선기능항진증 유발군은 동일 양의 생리식염수를 갑상선부위에 피하 주사하였고, 실험동물은 군당 5마리씩 정상군(Normal), LT4-유도 갑상선기능항진증 유발 대조군(control), 대조군에 MOK 약침액 고용량(3 mg/kg, High MOK) 및 저용량 투여군(0.3 mg/kg, Low MOK), 대조약물 투여군(PTU) 으로 구분하여 사용하였다.

Fig. 1.

The experimental schedule for hypothyroidism rat model. i.p., intraperitoneal; s.c., subcutaneously; and PTU, propylthiouracil.


2) 비장세포 분리

실험 종료 후 모든 실험동물을 희생시키고 비장(spleen)을 신속하게 적출하여 잘게 자른 다음 60 mesh 크기의 stainless steel mesh를 이용하여 단일세포(spleenocytes)를 유리시킨 후, 1x PBS를 넣고 5,000 rpm에서 5 분간 원심 분리하였다. 침전된 세포를 수거한 후 RBC lysis buffer(0.15 M-NH4Cl, 1M-KHCO3, 0.1 mM Na2EDTA)를 사용하여 적혈구를 제거하였다.

3) Reverse transcriptase-polymerase chain reaction(RT- PCR)

면역조절 사이토카인(IFN-γ, IL-4, IL-10, Foxp3)의 유전자 발현 변화를 분석하기 위해 비장세포로부터 RT-PCR을 시행하였다. Trizol 시약(Invitrogen, Carlsbad, CA, USA)을 사용하여 비장세포로부터 total RNA를 추출한 후 Superscript II reverse transcriptase(Invitrogen)을 사용해 cDNA를 합성하였다. cDNA와 각 사이토카인에 대한 primers(Table 2) 및 DNA polymerase (Promega, Road Madison, WI, USA)를 이용하여 PCR 조건을 94°C 45초, 58°C 45초, 72°C 60초 30회로 하여 PCR을 수행한 후 EtBr이 첨가된 1% agarose gel에서 전기영동하고 자동영상분석장치(ChemiDoc MP Imaging System, BioRad Laboratories, CA, USA)를 이용하여 발현 변화를 분석하였다.

Primers for PCR

 Name Forward(5‘→3’) Reverse(5‘→3’)
IFN- γ(XM_006532446.3)TCAACAACCCACAGGTCCAGCTTCCTGAGGCTGGATTCCG
IL-4(NM_021283.2)AGATGGATGTGCCAAACGTCCTCAAATATGCGAAGCACCTTGGAAGCC
IL-10(NM_010548.2)GGACAACATACTGCTAACCGACTGGATCATTTCCGATAAGGCTTG
Foxp3(NM_001199348.1)GGCCCTTCTCCAGGACAGAGCTGATCATGGCTGGGTTGT
GAPDH(NM_001289726.1)CTCGTGGAGTCTACTGGTGTGTCATCATACTTGGCAGGTT

4) 혈액 내 사이토카인 변화 측정

실험 종료 후 모든 실험동물을 희생시키고 복대정맥으로부터 혈액을 수집하였으며, 5,000 rpm에서 15분간 원심 분리하여 혈청(serum)을 분리하였다. 혈청 내 사이토카인(IFN-γ, IL-4)의 농도를 mouse IFN-γ ELISA kit(RIF00, R&D systems, Minneapolis, MN, USA), IL-4 ELISA kit(R4000, R&D systems, MN, USA)를 이용한 면역효소반응법(Enzyme- linked immunosorbant assay, ELISA)으로 측정하였다.

5) 통계학적 검정

모든 실험결과는 최소 3회 반복실험에 대한 평균과 표준편차(mean±SD)로 나타내었으며, 통계학적 유의성은 GraphPad Prism 5.0 분석프로그램(GraphPad Software, La jolla, CA, USA)의 one-way ANOVA와 Dunnett’s test를 이용하여 검정하여 p 값이 0.05 이하인 경우를 유의성 있는 것으로 판정하였다.

결과

1. MOK 약침의 혈청에서의 IFN-γ, IL-4 분비 조절 효과

갑상선기능항진증에서 MOK 약침의 Th1/Th2 면역조절 기전을 확인하기 위해, LT4에 의해 갑상선기능항진증이 유발된 랫드의 혈청으로부터 Th1 사이토카인인 IFN-γ와 Th2 사이토카인인 IL-4의 농도를 ELISA 방법으로 측정하였다. 그 결과 IFN-γ 분비는 정상군(155.22±10.88 pg/ml)에 비해 갑상선기능항진증 유발 대조군(192.61±12.78 pg/ml)에서 유의적으로 증가하였으며(p<0.05), 이는 저농도(Low MOK, p<0.01)와 고농도(High MOK, p<0.05)의 MOK 약침 처치군과 대조약물인 PTU 투여군(p<0.01)에서 각각 148.10±10.50 pg/ml, 158.92±1.89 pg/ml, 162.69±8.66 pg/ml으로 대조군에 비해 유의적으로 감소하였다(Fig. 2A). IL-4 분비에서는 정상군(46.18±2.81 pg/ml)에 비해 갑상선기능항진증 유발 대조군(39.04±0.86 pg/ml, p<0.01)에서 유의적으로 감소하였으며, 이는 저농도와 고농도의 MOK 약침 처치군(p<0.05, p< 0.001)과 PTU 투여군에서(p<0.05) 각각 42.28.10±1.28 pg/ml, 48.99±0.68 pg/ml, 45.74±1.51 pg/ml으로 유의적으로 증가하였다(Fig. 2B). 따라서 MOK 약침은 갑상선기능항진증 유발에 따른 IFN-γ 분비 증가를 감소시키고, IL-4 분비 저하를 증가시킴으로써 Th1/Th2 면역 불균형을 조절하는 효과가 있는 것으로 나타났다.

Fig. 2.

Effects of MOK pharmacopuncture on the changes of IL-4 and IFN-γ levels in sera of LT4-induced hyperthyroidic rats. MOK pharmacopuncture was subcutaneously administered once daily for 2 weeks during induction of LT4 induced hyperthyroidism in rats for 4 weeks. The serum levels of IFN-γ (A) and IL-4 (B) were measured by ELISA. Data are presented as mean±SD(n=5 per each group) and analyzed for statistical significance using ANOVA, followed by Dunnett’s test for multiple comparison. Normal : normal group, Vehicle : LT4-induced hyperthyroidism control group, Low MOK : MOK 0.3 mg/kg-treated group in control, High MOK : MOK 3.0 mg/kg-treated group in control, and PTU : PTU 10 mg/kg-treated group as a reference drug. *p<0.05, **p<0.01, and ***p<0.001 vs normal (a) or control (b). PTU, propylthiouracil; and LT4, L-thyroxine.


2. MOK 약침의 비장세포에서의 IFN-γ, IL-4, IL-10, Foxp3 유전자 발현 조절 효과

갑상선기능항진증에서 MOK 약침의 면역제어 기전을 확인해보기 위해, LT4에 의해 갑상선기능항진증이 유발된 랫드의 비장세포에서 Th1 사이토카인인 IFN-γ와 Th2 사이토카인인 IL-4 및 조절 T세포 사이토카인인 IL-10, Foxp3의 유전자 발현을 RT-PCR 방법으로 평가하였다. 그 결과, 비장세포에서의 IFN-γ 유전자 발현에 대한 결과는 통계적으로 유의한 결과가 나타나지 않았다. 반면, IL-4 유전자 발현은 정상군에 비해 대조군에서 유의적으로 감소하였고(p<0.001), MOK 약침 저농도 및 고농도 처치와 PTU 투여에 의해 증가하였으며, 고농도 MOK 처치군(p<0.05) 과 PTU 처리군(p<0.05)에 대해서 통계적 유의성이 있었다. IL-10 유전자 발현은 정상군에 비해 대조군에서 감소하였고(p<0.05), MOK 약침 처치와 PTU 투여에 의해 증가하였으며, 고농도 MOK 처치군(p<0.05)과 PTU 처치군(p<0.01)에 대해서 통계적 유의성이 있었다. Foxp3 유전자 발현은 정상군에 비해 대조군에서 감소하였고(p< 0.05), MOK 약침 처치(p<0.01 for MOK 0.3 mg/kg, p<0.05 for MOK 3 mg/kg)와 PTU 투여(p<0.01)에 의해 유의적으로 증가하였다(Fig. 3). 따라서 MOK 약침은 갑상선기능항진증 유발에 따른 비장에서의 IFN-γ, IL-4, IL-10, Foxp3 유전자 발현 감소를 증가시킴으로써 면역조절 효과를 나타내는 것으로 확인되었다.

Fig. 3.

Effects of MOK pharmacopuncture on the expression of IFN-γ, IL-4, IL-10, and Foxp3 mRNA in primary spleenocytes of LT4-induced hyperthyroidic rats. The expression of IFN-γ, IL-4, IL-10, and Foxp3 mRNA was detected in primary spleenocytes isolated from the spleen tissue by RT-PCR. (A) Representative figure of each cytokine expression and (B) histogram was analyzed using each target band per GAPDH as an internal control. Data are presented as mean±SD(n=5 per each group) and analyzed for statistical significance using ANOVA, followed by Dunnett’s test for multiple comparison. Normal : normal group, Vehicle : LT4-induced hyperthyroidic control group, Low MOK : MOK 0.3 mg/kg-treated group in control, High MOK : MOK 3.0 mg/kg-treated group in control, and PTU : PTU 10 mg/kg-treated group as a reference drug. *p<0.05, **p<0.01, and ***p<0.001 vs normal (a) or control (b). PTU, propylthiouracil; and LT4, L-thyroxine.


고찰

갑상선 질환 중 갑상선기능항진증으로 인한 진료비는 국민건강보험공단 진료현황 보고에서 2015년 기준 763억 원으로 2012년 694억 원 대비 9.8%(68억 원) 증가하였고, 2010년 총 진료비 617억 원에서 2014년 947억 원으로 증가하여 연평균 11.3% 증가를 나타내었다. 이처럼 현재 갑상선기능항진증환자가 증가하고 있으며, 최근 갑상선기능항진증이 유방암 발생의 위험을 높일 수 있다는 연구결과가 나와 더욱 관심의 대상이 되고있다18). 갑상선 질환은 한 번 발병하면 완치가 어렵고, 증세가 호전되었다고 하더라도 재발률이 높은 것이 특징이며, 연령이 증가할수록 빈도가 높아져서 향후 고령화 사회와 맞물려 더욱 증가할 것으로 예상된다. 이에 본 저자는 갑상선 질환 치료에서 양방에서의 호르몬대체요법과 다르게 MOK 약침을 활용한 침구치료를 통해 갑상선 질환을 효과적으로 치료할 수 있음에 착안하여, 그 효과에 대한 기전으로써 면역조절 작용을 밝히고자 본 연구를 수행하였다. MOK 약침은 심장에 潤을 보충해줄 수 있는 자하거 추출물인 냉성윤제 M과 우황, 사향, 웅담 등의 추출물인 氣劑 OK를 혼합하여 만든 약침액으로 기제에 윤이 들어가 있어 윤제의 성질을 지니게 되어 심장질환이나 갑상선질환에 효과가 우수한 것으로 알려져 있다. MOK 약침은 인체의 기혈순환을 도와주고 심신을 편안하게 하는 水升火降 치료법에 주로 쓰이며, 火性經絡 치료와 火喘일 경우에도 사용될 수 있다. 임상적으로도 驚悸, 怔忡, 不眠 등의 睡眠障碍, 狹心症, 갑상선기능항진증, 갑상선기능저하증, 갑상선비대, 갑상선종양, 화병 등의 다양한 질환에 활용하고 있다11).

T helper(Th) 세포에는 Th1 세포와 Th2 세포가 있으며 Th1 세포는 IFN-γ, IL-2, IFN-γ, IL-12 등 Th1 사이토카인을 주로 분비하고, Th2 세포는 IL-4, IL-5, IL-10, IL-13 등 Th2 사이토카인을 주로 분비하는 것으로 알려져 있다. Th1 사이토카인들은 지연형 과민 반응 조절과 세포 내 방어에 관여하며, Th2 사이토카인들은 항체 생성과 세포 외 방어에 관여한다. 따라서 Th1과 Th2 세포로부터 분비되는 각각의 사이토카인들은 서로 배타적으로 상호 작용하여 면역반응의 불균형을 유발하거나 또는 조절함으로써 면역조절에 중요한 역할을 담당하게 된다19). IFN-γ는 대표적인 Th1 사이토카인으로 산(acid)에 불안정한 type II interferon으로 산에 안정된 I형 interferon과 구분된다20). IFN-γ의 생성은 T 세포와 자연살해세포(natural killer, NK)가 마이토젠(mitogen), 항체, 혹은 항원에 의해서 자극 받음으로서 생성되며, MHC 항원 발현, 대식세포 활성화, NK세포 활성화, IgG isotype 조절, 항바이러스 활성, nitric oxide synthase(NOS) 유도 등에 관여하는 것으로 알려져 있다17). 본 연구에서 LT4 투여에 의해 갑상선기능항진증이 유발된 랫드의 혈청으로부터 IFN-γ의 분비 변화를 측정한 결과, 정상군에 비해 증가하였으며 이는 MOK 약침 처치에 의해 감소하는 것으로 나타났다. 이는 MOK 약침이 갑상선기능항진증 발생에 따른 Th1 사이토카인 분비 이상을 조절할 수 있음을 의미한다. 그러나 비장세포에서는 IFN-γ의 유전자 발현에 유의미한 변화가 관찰되지 않았는데 이는 갑상선기능항진증의 발병 정도에 따른 것으로 갑상선기능항진증에서 발병 초기에는 Th1 반응이 우세하지만, 진행될수록 Th2 반응이 우세하다는 보고가 있다16). 따라서 본 연구결과에서의 혈청과 비장세포에서 IFN-γ 결과의 불일치는 발병 정도 차이에서 기인하였을 것으로 사료된다.

IL-4는 대표적인 Th2 사이토카인으로 B 림프구의 DNA 합성을 자극하는 것으로 알려져 B 세포 성장인자(B cell growth factor, BCGF)로 명명되었으나, IL-4 분자가 휴지상태인 B세포의 MHC class II 분자의 발현을 증가시킨다는 것이 보고되면서 B세포 자극인자-1(B cell stimulatory factor-1, BCF-1)으로 제안되었다. IL-4는 주로 T 세포, 비만세포(mast cell), 호염기성 세포(basophilts)에서 생성되며, B세포에서 여러 표면분자의 발현, B 세포의 증식과 분화, T 세포 활성의 조절 등의 다양한 활성을 나타낸다19). 한편 IL-10은 Th2 세포, 대식세포, 활성화 T 세포, 비만세포 등 다양한 면역세포에서 생성되는 사이토카인으로 주로 Th1 사이토카인 생성을 억제함으로써 면역조절 작용을 나타낸다19). Foxp3(Forkhead family transcription factor 3)는 Foxp3 유전자 결함에 의해 CD4+ T 세포의 지나친 활성으로 Th2 cytokine의 과잉 생성이 관찰됨으로써 처음 그 존재가 알려지게 되었으며, 실제 CD4(+) CD25(hi) 조절 T 세포(regulatory T cell, Tregs)의 발달과 기능에 필수적인 역할을 하는 것으로 알려져 있다21). Tregs이 결핍된 동물에서는 바이러스 감염 시 바이러스 복제를 효과적으로 제어할 수 있는 반면 Tregs이 과도하게 발현되면 만성적 감염을 초래하는 것으로 알려져 있다22-24). Foxp3는 Tregs 발현에 필수적인 전사인자이며, Foxp3+ Tregs은 활성화된 T 세포 기능을 직접적으로 억제하거나 또는 IL-10이나 TGF-β와 같은 항염증 사이토카인 분비를 유도함으로써 과도한 면역반응 발생을 제어할 수 있다25). 또한 미감작된 T 세포에 Foxp3를 도입하면 표면에 CD25, CTLA-4, GITR 등의 유전자 발현이 증가되고, 또한 기능적으로 IL-2, IFN-γ 등의 분비를 억제하여 가장 합리적인 조절 T 세포의 기능적 지표로 여겨지고 있다21). 본 연구에서 MOK 약침은 LT4 투여로 갑상선기능항진증이 유발된 랫드의 혈액과 비장세포에서 Th2 사이토카인인 IL-4와 Tregs로부터 분비되는 IL-10 및 Foxp3 유전자의 발현을 증가시켰으며 이는 MOK 약침이 갑상선기능항진증에 따른 면역조절 이상을 회복시킬 수 있음을 의미한다. 한편 Foxp3가 과발현된 Tregs는 IRF4 의존적 기전이나 TGF-β와의 경쟁(competition)을 통해 Naive T 세포(Th0)에서 Th2 세포로의 분화를 억제할 수 있다고 알려져 있으며26) MOK 처치 시 정상군 보다 Foxp3의 발현이 더 증가하는 것으로 보아 MOK가 Th2 세포로의 분화를 억제할 수 있을 것으로 생각되지만 이에 대해서는 추가 연구가 필요하다.

본 연구에서는 대조약물로 항갑상선제인 PTU를 사용하여 MOK 약침의 면역조절 효과를 비교하였다. 본 연구결과에서 MOK 약침은 PTU 투여군과 유사하게 갑상선기능항진증으로 인한 Th1/Th2 불균형을 조절하는 것을 나타났다. 갑상선기능항진증에서의 MOK 약침의 Th1/Th2 면역조절효과는 본 연구자가 선행연구로부터 확인한 마우스 비장세포에서의 ConA-유도 Th1, Th2 사이토카인 분비 조절 효과27)와 일치하여 MOK 약침이 면역조절 작용을 가지고 있음을 알 수 있었다. 결론적으로, LT4 유도 갑상선기능항진증 랫트에서 MOK 약침은 Th1 사이토카인 IFN-γ 분비 증가를 감소시키고, Th2 사이토카인인 IL-4, IL-10와 Tregs 조절인자인 Foxp3의 발현 감소를 증가시킴으로써 갑상선기능항진증에서의 면역 불균형을 개선시킬 수 있음을 확인하였다. 다만, 본 동물모델은 외부에서 갑상선호르몬을 투여하여 갑상선기능항진 증상을 유도하는 모델로 실제 임상에서 자가면역에 따른 자가항체 생산과 이를 통한 갑상선 자극에 따른 증상 유발과 차이가 있어 본 연구 결과를 임상에 적용, 해석하는 데 한계가 있을 수 있다. 이에 대해서는 향후 보다 다양한 Th1/Th2 사이토카인들에 대한 조절 작용과 MOK 약침액의 구성약물이나 유효성분의 조절기전 및 본 모델 외 기타 실험동물 모델 추가 연구가 좀 더 이루어져야 할 것으로 사료된다.

결론

본 연구에서는 LT4-유도 갑상선기능항진증 유발 랫드에서 MOK 약침에 의한 Th1, Th2 사이토카인 분비 조절 작용을 평가하여 다음과 같은 결과를 얻었다.

1. MOK 약침은 갑상선기능항진증 유발에 따른 혈액 내 Th1 사이토카인인 IFN-γ의 증가를 감소시켰다.

2. MOK 약침은 갑상선기능항진증 유발 랫드로부터 분리된 비장세포에서 IFN-γ 발현 변화에 유의한 효과를 나타내지 않았다.

3. MOK 약침은 갑상선기능항진증 유발에 따른 혈액 내 Th2 사이토카인인 IL-4의 감소를 증가시켰으며, 비장세포에서의 IL-4 발현 감소를 증가시켰다.

4. MOK 약침은 갑상선기능항진증 유발 랫드로부터 분리된 비장세포에서 Th2 사이토카인 IL-10과 조절 T세포 사이토카인인 Foxp3의 유전자 발현 감소를 증가시켰다.

따라서 MOK 약침은 갑상선기능항진증에 따른 Th1/Th2 사이토카인 불균형 조절을 통해 개선시킬 수 있는 것으로 나타났다.

감사의 글

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. 2017R1C1B5076224).

References
  1. Doo HK. Oriental Medicine of Nephrology. Seoul: The Academy of oriental Medicine; 1993 p. 729.
  2. Korean Endocrine Society. Endocrinology. Seoul: Koonja publishing company; 2011 p. 129.
  3. Min HK. Clinical endocrinology. Korea Medical Book. Seoul 1999:155-169.
    Pubmed
  4. Kasper D, Braunwald E, Fauci A, Hauser S, Longo D, and Jameson J. Harrison's Internal Medicine. Seoul: Book publishing MIP; 2006 p. 2308-2323.
  5. Soma Masayoshi. Steps to internal medicine part 9. Seoul: Jeongdam; 2008 p. 55-65.
  6. Byun SH, Kim SI, Kang KH, Lee BC, Ahn YM, and Doo HK et al. The Analysis on Clinical Characteristics of Out-Patients of Oriental Thyroid Clinic. Korean J Orient Int Med 2005;26:213-220.
  7. Li L. Clinical study on acupuncture and moxibustion for treatment of hypofunction of spleen kidney yang deficiency of thyroid function. Heilongjang academy of traditional chinese medicine master's degree 2014.
  8. Lee M, and and Choi Y. Systemic Reviews of Domestic Experimental Studies of Herbal Medicines Used for Hypothyroidism since 2000. J. Int. Korean Med 2015;36:570-581.
    CrossRef
  9. Lee M, Jeon C, Kang MS, and Choi Y. Review of Domestic Experimental Studies of Herbal Medicines for Hyperthyroidism since 2000. J. Int. Korean Med 2016;37:949-960.
    CrossRef
  10. Hwang MS, Hwang JH, Kang SY, Kang AN, Roh HS, and Park YK. Effects study of Aconiti Lateralis Radix Preparata extract on the regulation of heat and cold in PTU-induced hypothyroidism rats. Kor J. Herbol 2016;31:63-71.
    CrossRef
  11. Kim ST, and Choi AR. Comparison of Effects of Yangkyuksanhwa- tang, Palmulgunja-tang and Cheongpyesagan-tang on the Rat Hyperthyroidism Induced by Levothyroxine. J Sasang Constitut Med 2016;28:132-146.
    CrossRef
  12. Kim SM, Kim SC, Chung IK, Cheon WH, and Ku SK. Antioxidant and Protective Effects of Bupleurum falcatum on the L-Thyroxine- Induced Hyperthyroidism in Rats. Evid Based Complement Alternat Med 2012;2012:578497.
    Pubmed KoreaMed CrossRef
  13. Park SI, Lee YJ, Choi SH, Park SJ, Song CH, and Ku SK. Therapeutic Effects of Blue Honeysuckle on Lesions of Hyperthyroidism in Rats. Am J Chin Med 2016;44:1441-1456.
    Pubmed CrossRef
  14. Jung C, Jung JH, and Lee MS. A clinical study of immune pharmacopuncturology. Kyungrak medical publishing co. Chungnam 2011:127-133.
  15. Hwang JH, Kang SY, Kang AN, Jung HW, Jung C, and Jung JH et al. MOK, a pharmacopuncture medicine, regulates thyroid dysfunction in L-thyroxine-induced hyperthyroidism in rats through the regulation of oxidation and the TRPV1 ion channel. BMC complementary and alternative medicine 2017;17:535.
    Pubmed KoreaMed CrossRef
  16. Inukai Y, Momobayashi A, Sugawara N, and Aso Y. Changes in expression of T-helper (Th) 1-and Th2-associated chemokine receptors on peripheral blood lymphocytes and plasma concentrations of their ligands, interferon-inducible protein-10 and thymus and activation-regulated chemokine, after antithyroid drug administration in hyperthyroid patients with Graves'disease. European journal of endocrinology 2007;156:623-630.
    Pubmed CrossRef
  17. Kristensen B. Regulatory B and T cell responses in patients with autoimmune thyroid disease and healthy controls. Dan Med J 2016;63:1-27.
  18. Søgaard M, Farkas DK, Ehrenstein V, Jørgensen JO, Dekkers OM, and Sørensen HT. Hypothyroidism and hyperthyroidism and breast cancer risk:a nationwide cohort study. Eur J Endocrinol 2016;174:409-414.
    CrossRef
  19. Mire-Sluis AR, and Thorpe R. CYTOKINES. San Diego, California: Academic Press; 1998 p. 19-400.
  20. Swain S, Brandley L, Croft M, Tonkonogy S, Atkins G, and Weinberg A et al. Helper T cell subsets:phenotype, function and role of lymphokines in regulating their development. Immunol Rev 1991;123:115-144.
    Pubmed CrossRef
  21. Brunkow ME, Jeffery EW, Hjerrild KA, Paeper B, Clark LB, and Yasayko SA et al. Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat. Genet 2001;27:68.
    Pubmed CrossRef
  22. Rouse BT, Sarangi PP, and Suvas S. Regulatory T cells in virus infections. Immunol. Rev 2006;212:272-286.
    Pubmed CrossRef
  23. Billerbeck E, Bottler T, and Thimme R. Regulatory T cells in viral hepatitis. World J. Gastroenterol 2007;13:Array.
    Pubmed KoreaMed CrossRef
  24. Li S, Gowans EJ, Chougnet C, Plebanski M, and Dittmer U. Natural regulatory T cells and persistent viral infection. J. Virol 2008;82:21-30.
    Pubmed KoreaMed CrossRef
  25. Wan YY. Regulatory T cells:immune suppression and beyond. Cell Mol. Immunol 2010;7:204-210.
    Pubmed KoreaMed CrossRef
  26. Schmidt A, Oberle N, and Krammer PH. Molecular mechanisms of treg-mediated T cell suppression. Frontiers in immunology 2012;3:51.
    Pubmed KoreaMed CrossRef
  27. JH Hwang. Effects of MOK, a pharmacopuncture medicine, on the TH1/TH2 immune response and antioxidation in Con A-stimulated primary mouse splenocytes. J Acupunc Res 2017;34:39-48.
    CrossRef


September 2018, 35 (3)
Full Text(PDF) Free


Cited By Articles
  • CrossRef (0)
Social Network Service
Services