search for




 

Effects of Crataegi Fructus Hot-Water Extract on Hair Growth and Growth Factor Gene Expression of Human Dermal Papilla Cells
산사 열수추출물의 모발 성장과 모유두세포의 성장인자 유전자 발현에 대한 영향
Korean J Acupunct 2017;34:146-155
Published online September 27, 2017;  https://doi.org/10.14406/acu.2017.017
© 2017 Society for Meridian and Acupoint.

Hyeong-Key Kim1, Cheol-Hong Kim2, Hyun-Min Yoon2, Kyung-Hwa Kang3, and Choon-Ho Song1
김형기1, 김철홍2, 윤현민2, 강경화3, 송춘호1

1Department of Meridian & Acupoint, College of Korean Medicine, Dong-Eui University,
2Department of Acupuncture & Moxibustion, College of Korean Medicine, Dong-Eui University,
3Department of Physiology, College of Korean Medicine, Dong-Eui University
1동의대학교 한의과대학 경락경혈학교실,
2동의대학교 한의과대학 침구학교실,
3동의대학교 한의과대학 생리학교실
Correspondence to: Choon-Ho Song Department of Meridian & Acupoint, College of Korean Medicine, Dong-Eui University, 52-57, Yangjeong-ro, Busanjin-gu, Busan 47227, Korea Tel: +82-51-850-8643, Fax: +82-51-853-4036, E-mail: chsong@deu.ac.kr
Received August 29, 2017; Revised September 18, 2017; Accepted September 22, 2017.
This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Objectives:

This study was carried out to investigate the effects of Crataegi Fructus water extract(CFWE) on hair growth in an alopecia model of C57BL/6N mice and human dermal papilla cells(hDPCs).

Methods:

Six-week old mice were depilated and separated in 3 groups; CON, MXD(2% Minoxidil), and CFWE. The treatments were applied twice a day for 18 days. The hair growth was determined photographically. The hair density, thickness and length were identified by Folliscope and the weights of body were measured. In dorsal skin tissue, the expression of hair growth-related protein was analyzed by Western blot. In hDPCs with/without IFN-γ, cell proliferation and the expression of hair growth-related genes were analyzed.

Results:

We observed that CFWE promoted hair growth compared to CON. CFWE improved the hair density, thickness and length compared to CON. CFWE increased the Wnt/β-catenin signaling in dorsal skin. In hDPCs, CFWE accelerated the cell proliferation and inhibited IFN-γ-induced hDPCs degeneration. CFWE increased the mRNA expression of β-catenin, Axin-2, BMP-4, FGF-7, FGF-10, and ALP compared to CON and IFN-γ treated cells.

Conclusions:

These results suggest that CFWE has a hair regrowth activity via Wnt/β-catenin signaling and can be useful for the treatment of alopecia.

Keywords: Crataegi Fructus water extract(CFWE), alopecia, C57BL/6N, human dermal papilla cells(hDPCs)
서론

모발의 성장은 모낭의 형성과 함께 시작된다. 모낭은 포유류에 존재하는 가장 복잡한 소형기관 중 하나이다. 모낭은 성장기(anagen), 퇴행기(catagen), 휴지기(telogen)의 주기적 변화를 반복한다. 성장기 때 모유두에 존재하는 모기질 세포와 멜라닌 형성세포의 증식에 의해 모발이 자라게 되고, 퇴행기에 모발의 성장을 종료하고 모근이 파괴되며 상피막이 수축되고 혈액공급이 중단되며, 휴지기에 모유두 활동이 멈추고 모발이 모공가까이 위치하여 모발이 탈락하게 된다. 이러한 모낭의 주기는 다양한 인자에 의해 영향을 받는다. 유전적 요인, 심리적 스트레스, 약물 부작용 등은 모낭주위 성장인자, 사이토카인과 호르몬 변화를 초래하고 모낭의 성장기 단축, 퇴행기로의 조기진행 등을 유도하여 탈모를 일으킨다1).

한의학에서 모발의 상태는 血의 상태에 영향을 받는데, 血이 부족하면 모발에 윤기가 없으며, 血이 열을 받으면 모발이 누렇게 되고, 血이 상하면 모발이 희어진다고 하였다2). 또 젊어서 머리털이 빠지는 것은 火, 怒火 또는 기름진 음식으로 인해 가슴에 熱과 濕痰이 생겨서 훈증되어 血이 마르기 때문이라고 보았다2).

山楂는 장미과(Rosaceae) 산사나무(Crataegus pinnatifida Bunge)의 잘 익은 열매로 성미가 酸甘 微溫하고 脾胃肝經에 귀경하여 消食健胃, 行氣散瘀, 化濁降脂 등의 효능을 지닌다3). 山楂에 대한 실험적 연구는 산화스트레스와 고지혈증4), 비만5), 당뇨6), 동맥경화증7) 등에 대한 억제 효과 보고가 있으며, 山楂의 육모에 대한 선행연구로 모낭의 퇴행기를 유도하는 apoptosis 기전을 억제하는 효과가 보고되었다8). 현재 탈모 치료를 위해 가장 일반적으로 사용되고 있는 약물인 Minoxidil(MXD)은 접촉성 피부염, 다모증, 피부소양감 등의 부작용이 보고되어 있다9). 반면, 山楂는 평소 잘못된 식습관 등으로 인한 두피 열감, 지루성 피부염 등 濕熱로 인한 모발의 이상에 효과적일 것으로 생각되어 본 연구를 진행하였다.

본 연구에서는 한의학적으로 신·방광이 모발성장과 연관된 점에 주목하여 경락경혈학적으로 족태양방광경이 순행하는 C57BL/6N 마우스의 등 부위 皮部에 山楂 열수추출물을 도포하여 약물을 흡수시키고, MXD를 양성대조군으로 사용하여 모발 성장효과와 모발성장에 관여하는 Wnt/β-catenin 신호전달 경로 활성화를 확인하였다. 또한 사람 유래 모유두 세포(human dermal papilla cells, hDPCs)의 증식과 모발 성장인자의 유전자 발현 증가를 확인하여 이에 유효한 결과를 얻었기에 보고하는 바이다.

재료 및 방법

1. 시약

본 실험에 사용된 시약으로 Mobarin(Minoxidil, MXD)과 Bikiro cream은 Tai Geuk Pharm. Co., Ltd.(Hwaseong, Korea)로부터, chloroform, isopropanol은 Sigma(St. Louis, MO, USA)로부터, RT-PCR kit(one-step RT-PCR premix kit)는 Intron Biotechnology, Inc.(Sungnam, Korea)로부터, primer는 Bioneer (Daejeon, Korea)로부터 구입하여 사용하였다. Wnt3α, Wnt5α, β-catenin과 β-actin primary antibody는 Santa Cruz Biotechnology(Santa Cruz, CA, USA)로부터, goat anti-mouse IgG (HRP)-conjugated secondary antibody는 Enzo Life Sciences, Inc(Farmingdale, NY 11735, USA)로부터, nitrocellulose membrane은 Bio-RAD Laboratories, Inc(Germany)로부터 구입하여 사용하였다.

2. 실험동물

실험동물은 6주령의 C57BL/6N male mice를 (주)Samtako(Osan, Korea)로부터 구입하여, 온도 23±3°C, 상대습도 50±10%, 12시간 조명주기 조건하에서 식이와 식수를 자유롭게 섭취하도록 하였으며 7일간의 적응기간을 거친 후 실험에 사용하였다. 실험동물의 관리와 모든 실험과정은 Guide for the care and use of laboratory animals(8th edition, The National Academies Press, Washington, D.C.)에 준하여 시행하였다.

3. 山楂 열수추출물의 준비

본 실험에 사용된 山楂(Crataegi Fructus)는 국내 경북에서 생산된 것으로 옴니허브(Yeongcheon, Korea)에서 구입하여 사용하였다. 山楂 100 g을 물로 세척 후 증류수(distilled water, DW) 1 L를 첨가하여 100°C에서 2시간 30분 동안 가열하여 추출하였다. 여과 후 실온에서 냉각시킨 뒤 동결건조하여 건중량 4.5 g의 추출물(Crataegi Fructus water extract, CFWE)을 획득하였다. 추출물은 20°C에 보관하였다가 실험직전 DW와 propylene glycol을 3:1 혼합한 용액에 2%의 농도로 녹여 사용하였다.

4. 실험군 설정 및 처치

실험군은 제모 후 대조군(CON), CFWE 도포군(CFWE), Minoxidil 도포군(MXD)으로 나누었고, 한 군에 5마리씩 배정하였다.

Mice는 일차적으로 마우스용 clipper를 이용하여 등 부위의 털을 깎고, 이차적으로 제모제 Bikiro cream을 발라 피부 속에 남아있는 모낭과 미세한 털을 모낭이 눈에 보이지 않을 때까지 제거하고 24시간 동안 방치하여 미세 상처가 회복되도록 하였다. CON군은 DW와 propylene glycol을 3:1 혼합한 용액을, MXD군은 2% Minoxidil 용액을, CFWE군은 2% 山楂 추출물을 각각 200 μl씩, 하루에 2번, 제모한 부위에 면봉을 이용하여 18일간 도포하였다(Scheme 1).

Fig. 1.

Experimental process.

Dorsal hairs of 6-week-old C57BL/6N mice were depilated to synchronize anagen induction. The mice were divided into following three groups: group 1, normal vehicle-treated negative control; group 2, CFWE-treated experimental group; group 3, 2% Minoxidil-treated positive control. Each agent were topically twice a day after hair depilation. Dorsal skin lesions were collected at the 7th day after depilation and analyzed by western blotting., Topical treatment with normal vehicle(DW plus propylene glycol(3:7) mixture), 2% CFWE or 2% Minoxidil.



5. 피부의 육안적 관찰 및 모발 측정

제모를 시행한 날부터 3일 주기로 체중을 측정하였으며, 시료를 도포하기 시작한 날을 실험 1일째로 정하여 피부에서 일어나는 발모와 관련된 특징들을 관찰하면서 디지털카메라(SONY, Japan)를 이용하여 촬영하였다.

모낭이 형성된 부위와 발모부위는 Folliscope(Lead M, Seoul, Korea)로 촬영하여 모발의 밀도와 굵기를 관찰하였고, 핀셋을 사용하여 털을 뽑아 Folliscope(Lead M, Seoul, Korea)하에서 길이를 측정하였다.

6. Western blotting

마우스의 등 피부 조직으로부터 Wnt3α, Wnt5α와 β-catenin 단백질의 발현을 분석하기 위하여 −80°C에 보관하고 있던 등 피부 조직 0.2 g에 lysis buffer 500 μl를 첨가하여 homogenizer로 분쇄시켜 원심분리하여 단백질을 정량하였다.

단백질 25 μg을 l0% sodium dodecyl sulfate polyacrylamide gel electrophoresis(SDS-PAGE)로 분리하고, nitrocellulose membrane으로 transfer하였다. Transfer된 membrane은 Tris-buffered saline Tween-20(TBST) (20 mM Tris, pH 7.6, 136 mM NaCl, 0.1% Tween 20)에 용해된 5% skim milk에 1시간 동안 실온에서 blocking하였다.

Primary antibody는 1:1000으로 희석하여 4°C에서 overnight 하였으며, TBST로 3회 세척하고 HRP-conjugated secondary antibody(1:1000 dilution)로 1시간동안 실온에서 반응시킨 후, ECL system을 이용하여 각 factor의 발현을 조사하였다.

7. 세포배양

hDPCs는 Cefobio(Seoul, Korea)에서 구입하였으며, 5% fetal bovine serum(FBS; Invitrogen/Gibco-BRL)과 1% penicillin을 함유한 Dulbecco’s modified Eagle’s medium(DMEM; Invitrogen/Gibco-BRL, Grand Island, NY, USA)에서 배양하였다. hDPCs는 4번째 계대배양의 세포를 실험에 사용하였다.

8. 세포증식 측정

hDPCs의 증식은 MTT(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide) assay를 사용하여 측정하였다. 모낭의 퇴행기를 강력하게 유도하는 인자인 IFN-γ를 100 ng/ml의 농도로 처리하지 않거나 처리한 상황에서 CFWE를 농도별(0, 25, 50, 100, 200 ng/ml)로 처리한 후 3일간 배양하였다. MTT(0.5 mg/ml)를 처리하여 4시간동안 배양한 후 배지를 제거하였다. 실온에서 생성된 formazan을 용해하기 위해 DMSO를 처리한 후 흡광도 540 nm에서 값을 측정하였다.

9. RT-PCR

IFN-γ(100 ng/ml)를 처리하지 않거나 처리한 상황에서 25 ng/ml CFWE를 3일간 처리한 모유두세포는 Trizol법을 사용하여 RNA를 추출하였다.

RT-PCR은 one-step RT-PCR premix kit(iNtRON Biotechnology Inc., Sungnam, Korea))를 사용하여 45°C에서 30분, 94°C에서 5분간 반응시킨 후 94°C에서 30초간 denaturation시키고, 적정온도에서 30초간 annealing시킨 다음, 72°C에서 1분간 extension시키는 cycle을 30회 반복한 뒤, 마지막 extension은 72°C에서 5분간 PCR machine(GeneAmp, PCR system 9700, USA)에서 수행하였다. 각 PCR products는 2% agarose gel에 loading하여 100 V 조건에서 30분간 전기영동을 통하여 분석하였다. Primer는 β-catenin, Axin-2, BMP-4, FGF-7, FGF-10, ALP와 GAPDH를 사용하였으며 염기 서열은 다음과 같다(Table 1).

Primers for RT-PCR Analysis

Target gene  Sequence 5’-3’  Annealing°C/cycles 
β−Catenin Sense ATGACTCGAGCTCAGAGGCT 53/30
Anti-sense GAACTTGCCACACGTGCAAT
Axin-2 Sense GTGAAGGCCAATGGCAGAGT 56/30
Anti-sense  CTCACACTCAATTCGCGGGA
BMP-4 Sense ACCGAATGCTGATGGTCGTT 54/30
Anti-sense GGAGGAGGAGGAAGAGCAGA
FGF-7 Sense TCTTCTGTCTGGCAGTTGGA 53/30
Anti-sense TTGCCATAGGAAGAAAGTGG
FGF-10 Sense ACTTTCGGAGAACTGCATCG 53/30
Anti-sense AGTGGGAGCTCCTTTTCCAT
ALP Sense TCGTTGACACCTGGAAGAGC 57/30
Anti-sense AGGAGGCAGAATTGACCACG
GAPDH Sense GAGAAGGCTGGGGCTCATTT 55/30
Anti-sense CCACAGTCCATGCCATCACT


10. 통계처리

실험결과는 통계 프로그램 패키지 GraphPad Prism®5(GraphPad Software Inc., San Diego, CA, USA)를 사용하여 평균치±표준편차로 나타내었고 유의수준은 p<0.05로 하였다. 각 실험군 간의 통계학적 분석은 one way-ANOVA와 Dunnett’s post hoc multiple comparison tests 또는 two-way repeated-measures ANOVA와 Bonferroni post hoc multiple comparison tests를 실시하였다.

결과

1. 발모현상 관찰

제모한 배부의 발모상태를 육안적으로 관찰한 결과 실험 4일째는 모든 군에서 육안적인 발모현상을 전혀 관찰할 수 없었다.

실험 7일째는 CON군에서는 피부가 부분적으로 연한 회색으로 변하였으나 육안적인 발모현상은 관찰할 수 없었다. CFWE군과 MXD군에서는 모두 피부가 부분적으로 진한 회색으로 변하고 부분적인 발모현상이 관찰되었으며 CFWE군, MXD군, CON군 순으로 발모현상이 촉진되는 것이 관찰되었다.

실험 11일째는 CON군에서는 모두 피부가 부분적으로 회색으로 변하였고 부분적인 발모현상이 관찰되었다. CFWE군과 MXD군에서는 부분적으로 증가된 발모현상이 관찰되었으며 CFWE군, MXD군, CON군 순으로 발모현상이 촉진되는 것이 관찰되었다.

실험 14일째는 CON군에서는 전체적으로 발모가 시작되는 현상이 관찰되었다. CFWE군과 MXD군에서는 모두 전체적으로 증가된 발모현상이 관찰되었으며 MXD군, CFWE군, CON군 순으로 발모현상이 촉진되는 것이 관찰되었다.

실험 18일째는 CON군에서는 전체적으로 증가된 발모현상이 관찰되었다. CFWE군과 MXD군에서는 모두 전체적으로 현저하게 증가된 발모현상이 관찰되었다(Fig. 1).

Fig. 2.

Photograph of hair regrowth in depilated C57BL/6N mice after topical application of CFWE and MXD on 4, 7, 11, 14, and 18 days.

The dorsal skins of mice were shaved and applied hair removal cream externally, and the test treatments were applied twice a day for 18 days. CON was treated with 200μl of DW: propylene glycol(3:7) solution as a vehicle. CFWE was treated with 200μl of 2% CFWE in vehicle. MXD was treated with 200μl of 2% Minoxidil in vehicle.



2. 모발의 밀도, 굵기 및 길이 변화에 미치는 영향

1) 모발의 밀도 변화

Folliscope 50배율에서 1 cm2 내의 모발의 밀도를 측정한 결과, 실험 7일째는 CON군, MXD군, CFWE군이 각각 25.2±17.99, 210.6±145.9, 291.0±98.18/cm2으로 나타났고, 실험 11일째는 CON군, MXD군, CFWE군이 각각 1051.0±504.7, 1945.0±614.6, 2386.0±360.6/cm2으로 나타났으며, 실험 14일째는 CON군, MXD군, CFWE군이 각각 2162.0±604.5, 2678.0± 420.9, 3012.0±461.6/cm2으로 나타났다(Fig. 2).

Fig. 3.

Effect of CFWE on hair density in an alopecia model of C57BL/6N mice by Folliscope(×50 magnification).

All data are expressed as the mean±standard deviation(S.D.) of 5 mice per group. One-way ANOVA and Dunnett’s post hoc multiple comparison tests were used to assess statistical significance. *p<0.05, **p<0.01 vs="" con="" p="">


2) 모발의 굵기 변화

Folliscope 100배율에서 모발의 굵기를 측정한 결과, 실험 7일째는 CON군, MXD군, CFWE군이 각각 0.006±0.004, 0.008±0.001, 0.011±0.002 mm로 나타났고, 실험 11일째는 CON군, MXD군, CFWE군이 각각 0.010±0.006, 0.019±0.006, 0.025±0.005 mm로 나타났으며, 실험 14일째는 CON군, MXD군, CFWE군이 각각 0.015±0.004, 0.025±0.007, 0.029±0.007 mm로 나타났다(Fig. 3).

Fig. 4.

Effect of CFWE on hair thickness in an alopecia model of C57BL/6N mice by Folliscope(×100 magnification)

All data are expressed as the mean±S.D. of 5 mice per group. One-way ANOVA and Dunnett’s post hoc multiple comparison tests were used to assess statistical significance. *p<0.05, **p< 0.01, ***p<0.001 vs="" con="" p="">


4) 모발의 길이 변화

제모 후 7일, 11일, 14일째 모발의 길이를 측정한 결과, 실험 7일째는 CON군, MXD군, CFWE군이 각각 0.10±0.05, 0.52±0.17, 0.43±0.16 mm로 나타났고, 실험 11일째는 CON군, MXD군, CFWE군이 각각 0.51±0.26, 0.92±0.38, 1.00±0.46 mm로 나타났으며, 실험 14일째는 CON군, MXD군, CFWE군이 각각 1.16±0.63, 2.88±1.05, 2.60±0.77 mm로 나타났다(Fig. 4).

Fig. 5.

Effect of CFWE on hair length in an alopecia model of C57BL/6N mice.

All data are expressed as the mean±S.D. of 5 mice per group. One-way ANOVA and Dunnett’s post hoc multiple comparison tests were used to assess statistical significance. *p<0.05, **p< 0.01, ***p<0.001 vs="" con="" p="">


3. 체중변화에 미치는 영향

CFWE군과 MXD군에서 시험물질의 피부 도포가 체중변화에 미치는 영향을 확인하기 위해 제모 후 4일, 7일, 11일, 14일, 18일째 체중을 측정한 결과 CON군, CFWE군과 MXD군의 체중은 각 실험군 간의 유의한 차이는 없었다(Fig. 5).

Fig. 6.

Effect of CFWE on body weight in an alopecia model of C57BL/6N mice.

All datas are expressed as the mean±S.D. of 5 mice per group.



4. Wnt/β-catenin 신호전달 단백질 발현에 미치는 영향

CFWE군과 MXD군에서 시험물질의 피부 도포가 Wnt3α, Wnt5α와 β-catenin 발현에 미치는 효과를 살펴본 결과 마우스의 7일째 등 피부 조직 CFWE군에서 MXD군과 유사하게 Wnt3α, Wnt5α와 β-catenin 발현이 모두 현저하게 증가하였다(Fig. 6).

Fig. 7.

Effect of CFWE on protein expression of Wnt/β-catenin signaling involved in anagen development.

Dorsal skins were collected from C57BL/6N mice on day7 after depilation. Western blot method was used to determine the expression of Wnt3α, Wnt5α, and β-catenin at the translational level. β-actin was used as internal control protein.



5. hDPCs의 증식에 미치는 영향

성장기 모낭을 퇴행기로 유도하는 IFN-γ를 처리하지 않은 조건과 처리한 조건에서 모발의 생성과 성장에 핵심적인 역할을 하는 모유두세포의 증식에 미치는 CFWE의 영향을 확인하였다. IFN-γ는 hDPCs 증식을 현저하게 감소시켰으며, CFWE는 농도 의존적이지는 않으나 25∼200 ng/ml의 농도에서 IFN-γ의 처리하지 않은 조건과 처리한 조건에서 모두 hDPCs 증식의 유의한 증가를 나타내었다(Fig. 7).

Fig. 8.

Effect of CFWE on the hDPCs proliferation and IFN-γ-mediated hDPCs reduction.

hDPCs were treated with 100 ng/ml of IFN-γ, 25, 50, 100 and 200 ng/ml of CFWE, or with both IFN-γ and CFWE for 3 days, and MTT assay was assessed on day 3. MXD served as a positive control for hDPCs promotion. Results were expressed as mean±SD of compared to the control. Statistically significant differences were determined by ANOVA(*p<0.05, **p<0.01, ***p<0.001 vs="" untreated="" cells="" italic="">p<0.001 vs="" ifn-="" treated="" cells="" p="">



6. 모낭 및 모발의 성장조절 유전자 발현에 미치는 영향

1) β-catenin 관련 유전자 발현 변화

모발의 발생과 성장은 세포내 Wnt신호전달 경로의 활성과 관련된다. Wnt 신호전달경로의 핵심적인 유전자인 β-catenin과 Axin-2의 유전자 발현 증가를 관찰하여 CFWE가 모낭 및 모발의 성장조절 유전자 발현에 미치는 영향을 확인하였다.

그 결과 시험물질 처리 3일 후 CFWE는 CON에 비해 β-catenin과 Axin-2 유전자 발현을 증가시켰다. 그러나 IFN-γ는 CON에 비해 β-catenin과 Axin-2 유전자 발현을 감소시키지는 못했으나, CFWE가 IFN-γ 처리 하에서 이들 유전자의 발현을 증가시키는 것을 확인하였다(Fig. 8).

Fig. 9.

Effect of CFWE on the expression of β-catenin and Axin-2 mRNA in hDPCs and IFN-γ-mediated hDPCs.

RNA was isolated from the hDPCs at day 3. Detection of mRNA was examined by RT-PCR analysis as described in Materials and Methods. GAPDH was used as internal control genes.


2) hDPCs 특징적 유전자 발현 변화

모발의 성장과 관련된 hDPCs 특징 유전자 bone morphogenic protein-4(BMP-4), fibroblast growth factor-7(FGF-7)과 FGF-10 유전자 발현 변화를 관찰하여 CFWE가 모낭 및 모발의 성장조절 유전자 발현에 미치는 영향을 확인하였다. 그 결과 시험물질 처리 3일 후 CFWE는 CON에 비해 BMP-4, FGF-7과 FGF-10 유전자 발현을 증가시켰다. 그러나 IFN-γ는 CON에 비해 BMP-4, FGF-7과 FGF-10 유전자 발현의 변화를 보이지 않았으나, CFWE가 IFN-γ 처리 하에서 이들 유전자의 발현을 증가시키는 것을 확인하였다(Fig. 9).

Fig. 10.

Effect of CFWE on the expression of BMP-4, FGF-4, and FGF-10 mRNA in hDPCs and IFN-γ-mediated hDPCs.

RNA was isolated from the hDPCs at day 3. Detection of mRNA was examined by RT-PCR analysis as described in Materials and Methods. GAPDH was used as internal control genes.


3) Alkaline phosphatase(ALP) 유전자 발현 변화

hDPCs의 증식과 모발성장을 유도하는 ALP 유전자 발현 변화에 미치는 CFWE의 영향을 확인하였다. 그 결과 시험물질 처리 3일 후 CFWE는 CON에 비해 ALP 유전자 발현을 증가시켰다. 그러나 IFN-γ는 CON에 비해 ALP 유전자발현의 변화를 보이지 않았으나, CFWE가 IFN-γ 처리 하에서 ALP 유전자의 발현을 증가시키는 것을 확인하였다(Fig. 10).

Fig. 11.

Effect of CFWE on the expression of ALP mRNA in hDPCs and IFN-γ-mediated hDPCs.

RNA was isolated from the hDPCs at day 3. Detection of mRNA was examined by RT-PCR analysis as described in Materials and Methods.


고찰

모발은 광범위한 기능을 수행하는데, 포유동물에서 신체보호, 보온, 위장, 땀과 피지의 분산, 감각 및 촉각기능, 사회적 상호작용을 한다. 인간에서도 모발은 정신사회적 중요성을 지니고 있으며 많은 질병이 탈모와 관련되어있다1). 탈모는 일생 동안 절반 정도의 남성과 여성에게 발생하고10), 국소형 탈모로는 원형탈모와 두부백선이 있으며, 범발성 탈모로는 여성형 탈모, 남성형 탈모, 휴지기 탈모, 성장기 탈모 등이 있다10). 발병 요인으로 유전적 요인, 호르몬 변화, 심리적 스트레스, 약물 부작용 등이 모낭주위 성장인자, 사이토카인과 호르몬 변화를 초래하고 모낭의 성장기 단축, 퇴행기로의 조기진행 등을 유도하여 탈모를 일으키는 것으로 알려져 있다1).

山楂는 신농본초경집주에 적조목의 열매로 수록되어 있는데 일명 ‘羊梂’ 또는 ‘鼠査’라 하였으며 그 맛은 시고 성질은 冷하며 무독하다고 하였고, 水痢를 주치하며 머리나 몸의 瘡癢에는 달인 물로 씻는다고 하였다11).

본 연구에서는 CFWE가 제모 후 모발의 재생성과 성장을 유도하는 효능과 기전에 대해 조사하였다. 육안적 관찰결과 CFWE군은 CON군에 비해 현저하게 빠른 모발성장을 나타내었고, MXD군에 비해서도 빠른 모발성장을 나타내었다(Fig. 1). 모발의 밀도, 굵기, 길이 관찰결과도 육안적 관찰결과와 유사하게 CFWE군, MXD군, CON군 순으로 증가 효과를 나타내었다(Figs. 24). 반면, 각 실험군 간 체중은 유의한 변화가 없었는데(Fig. 5) 이러한 결과는 시료의 도포가 stress로 작용하지 않은 것으로 생각된다.

Wnt family는 분화, 세포 이주 및 성장에 관여하는 분비성 당단백질로 다양한 Wnt단백질이 발견되었다. 분비된 세포외부 Wnt ligands는 세포막 표면 수용체(Frizzled family)를 통해 Wnt 신호전달을 활성화시킴으로써 β-catenin을 안정화시키고 핵 내로 이동하여 TCF/LEF 전사인자에 결합하도록 유도한다. 이러한 복합체는 증식, 분화와 이주에서 Wnt 신호전달의 다양한 기능을 수행하기 위한 하위 표적유전자의 전사를 조절한다. Wnt/β-catenin 신호전달의 활성은 모발의 생성과 유지뿐만 아니라 모낭의 재생산과 모기질의 성장에도 중요하다12,13). Wnt3α는 canonical Wnt 신호전달경로를 매개하여 β-catenin 안정화를 유도하여 모발성장에 영향을 미치며, 모낭 멜라닌세포의 항상성을 유지한다13,14). Wnt5α는 많은 발달 과정에 연루되고 다양한 세포내 신호전달을 활성화시킬 수 있다. Wnt5α는 Wnt/β-catenin 신호를 약화시킴으로써 모낭 공간을 조절하여 이소성 β-catenin/TCF 신호에 의해 초래될 수 있는 조숙하거나 불필요한 모낭형성을 예방한다15,16).

본 연구에서 실험 7일째 C57BL/6N 마우스의 등 피부 조직을 채취하여 모발의 재생성과 성장과 관련된 Wnt/β-catenin 신호전달 기전의 활성을 살펴본 결과, MXD군과 CFWE군은 대조군에 비해 Wnt3α, Wnt5α와 β-catenin의 활성이 증가하였다(Fig. 6). 이러한 결과는 CFWE의 모발 생성과 조절효과가 직접적으로 Wnt3α와 Wnt5α를 통하여 β-catenin의 활성을 조절함으로써 일어난다는 것을 나타낸다.

모발의 성장은 모유두 세포에 존재하는 모기질 세포와 멜라닌 형성세포의 증식에 의해 일어난다. IFN-γ는 모낭주기의 조절에 관여하는 많은 사이토카인 중의 하나로17-20), IFN-γ를 과발현시킨 두 계통의 유전자 변형 마우스에서 모두 탈모를 유발하였다21,22). 최근 연구들은 IFN-γ가 정상 사람의 두피 모낭에서 강력한 퇴행기 유도제이며 모기질과 모유두세포에서 모두 IFN-γRβ를 발현한다고 보고하였다23).

따라서 본 연구에서는 모낭의 조기퇴행기를 유도하는 IFN-γ가 존재하거나 존재하지 않는 조건에서 CFWE가 hDPCs의 증식에 미치는 영향을 조사하였다. 그 결과 CFWE는 hDPCs의 증식을 유의하게 증가시켰으며, IFN-γ로 인한 hDPCs의 증식 감소를 회복하였다(Fig. 7). 이는 CFWE가 hDPCs에서 성장기 상태를 유지시키고 모낭의 IFN-γ 유도 퇴행기 전환을 방지하는 것을 보여주는 결과이다.

β-catenin knockout mice는 모낭의 퇴행기와 휴지기가 조기에 유도되어 모낭재형성에 실패하였다. 이는 모유두세포에서 β-catenin의 활성화가 모낭의 성장기를 연장하고 모발 성장을 촉진할 수 있다는 것을 나타낸다24).

본 연구에서 hDPCs에서 모낭 및 모발의 성장조절 유전자 발현에 미치는 영향을 알아보았다. 그 결과, CFWE는 Wnt/β-catenin 기전과 관련된 핵심 유전자인 β-catenin과 Axin-2의 발현, 모발의 성장과 관련된 특징적인 유전자인 BMP-4, FGF-7, FGF-10 유전자의 발현과 hDPCs의 증식과 모발성장을 유도하는 ALP 유전자의 발현을 증가시켰다(Figs. 810). 이는 CFWE가 β-catenin 유전자 발현을 증가시킴으로써 IFN-γ 유도 모낭 퇴행기 변화에 대응할 수 있는 hDPCs의 특징적인 유전자들 발현을 증가시키고 모낭 주기와 모발의 성장을 조절하는 것을 보여주는 결과이다.

이러한 결과를 종합해볼 때 CFWE는 Wnt/β-catenin 신호전달경로의 활성화를 통해 C57BL/6N 마우스의 모발 성장을 촉진하고, hDPCs의 증식과 모낭의 성장을 촉진하며, IFN-γ로 인한 hDPCs의 감소와 모낭의 조기퇴행기 유도 회복에 유의한 효과가 있는 것이 확인되었다. 또한 추가적인 연구를 통해 잘못된 식습관으로 인한 두피 열감과 지루성 피부염으로 인한 濕熱을 동반하는 탈모와 IFN-γ 매개 병리적 탈모에 CFWE가 적용될 수 있을 것으로 기대되며, 향후 경락과 경혈을 활용한 탈모 치료에 대한 약침요법의 임상적 효능을 입증할 수 있는 기초자료 마련에 조금이나마 일조를 할 것으로 생각된다.

결론

C57BL/6N 마우스 모델에서 山楂 열수추출물(CFWE)의 모발 성장과 모유두세포의 성장인자 유전자 발현에 대한 영향을 연구하여 다음과 같은 결과를 얻었다.

1. 피부의 육안적 관찰 결과 CFWE군과 MXD군은 CON군에 비해 발모현상이 촉진되는 것을 관찰하였다

2. Folliscope를 이용한 모발의 밀도, 굵기 및 길이를 관찰한 결과 CFWE군과 MXD군은 CON군에 비해 증가를 보였다.

3. 체중변화를 관찰한 결과 각 실험군 간의 유의한 차이는 없었다.

4. 모발의 성장과 관련된 hDPCs의 β-catenin, Axin-2, BMP-4, FGF-7, FGF-10과 ALP 유전자의 발현량을 증가시켰다. 또한 모낭의 퇴행기를 유도하는 IFN-γ에 의한 β-catenin, Axin-2, BMP-4, FGF-7, FGF-10과 ALP 유전자 감소를 회복시켰다.

이상에서 CFWE가 모발 성장을 촉진하고 모유두세포의 증식과 모낭의 성장을 촉진하며 모유두세포의 감소와 모낭의 조기퇴행 회복에 유의한 효과가 있음을 확인하였다.

감사의 글

This work was supported by Dong-eui University Grant (201702640001).

References
  1. Schneider MR, Schmidt-Ullrich R, and Paus R. The hair follicle as a dynamic miniorgan. Current biology:CB 2009;19:R132-42.
    Pubmed CrossRef
  2. Heo J. Dongeuibogam. Seoul: Koryeomoonwhasa; 1997 p. 307-10.
  3. Defining Dictionary for Medicinal Herbs [Korean, ‘Hanyak Giwon Sajeon’] [Internet] 2016.
    Available from: http://boncho.kiom.re.kr/codex/ [cited 2016-12-10]
  4. Shao F, Gu L, Chen H, Liu R, Huang H, and Ren G. Comparation of Hypolipidemic and Antioxidant Effects of Aqueous and Ethanol Extracts of Crataegus pinnatifida Fruit in High-Fat Emulsion-Induced Hyperlipidemia Rats. Pharmacognosy magazine 2016;12:64-9.
    Pubmed KoreaMed CrossRef
  5. Lee YH, Kim YS, Song M, Lee M, Park J, and Kim H. A Herbal Formula HT048, Citrus unshiu and Crataegus pinnatifida, Prevents Obesity by Inhibiting Adipogenesis and Lipogenesis in 3T3-L1 Preadipocytes and HFD-Induced Obese Rats. Molecules(Basel, Switzerland) 2015;20:9656-70.
    Pubmed CrossRef
  6. Chowdhury SS, Islam MN, Jung HA, and Choi JS. In vitro antidiabetic potential of the fruits of Crataegus pinnatifida. Research in pharmaceutical sciences 2014;9:11-22.
    Pubmed KoreaMed
  7. Zhang J, Liang R, Wang L, Yan R, Hou R, and Gao S et al. Effects of an aqueous extract of Crataegus pinnatifida Bge. var. major N.E.Br. fruit on experimental atherosclerosis in rats. J Ethnopharmacol 2013;148:563-9.
    Pubmed CrossRef
  8. Shin HS, Lee JM, Park SY, Yang JE, Kim JH, and Yi TH. Hair growth activity of Crataegus pinnatifida on C57BL/6 mouse model. Phytother Res 2013;27:1352-7.
    Pubmed CrossRef
  9. American Academy of Pediatrics Committee on Drugs:The transfer of drugs and other chemicals into human milk. Pediatrics 1994;93:137-50.
    Pubmed
  10. Mounsey AL, and Reed SW. Diagnosing and treating hair loss. American family physician 2009;80:356-62.
    Pubmed
  11. Tang SW. Classified Emergency Materia Medica. Beijing: People’s Medical Publishing House; 1982 p. 356.
  12. Leiros GJ, Attorresi AI, and Balana ME. Hair follicle stem cell differentiation is inhibited through cross-talk between Wnt/beta-catenin and androgen signalling in dermal papilla cells from patients with androgenetic alopecia. The British journal of dermatology 2012;166:1035-42.
    Pubmed CrossRef
  13. Guo H, Yang K, Deng F, Ye J, Xing Y, and Li Y et al. Wnt3a promotes melanin synthesis of mouse hair follicle melanocytes. Biochemical and biophysical research communications 2012;420:799-804.
    Pubmed CrossRef
  14. Ouji Y, Nakamura-Uchiyama F, and Yoshikawa M. Canonical Wnts, specifically Wnt-10b, show ability to maintain dermal papilla cells. Biochemical and biophysical research communications 2013;438:493-9.
    Pubmed CrossRef
  15. van Amerongen R, Fuerer C, Mizutani M, and Nusse R. Wnt5a can both activate and repress Wnt/beta-catenin signaling during mouse embryonic development. Developmental biology 2012;369:101-14.
    Pubmed KoreaMed CrossRef
  16. Narhi K, Jarvinen E, Birchmeier W, Taketo MM, Mikkola ML, and Thesleff I. Sustained epithelial beta-catenin activity induces precocious hair development but disrupts hair follicle down-growth and hair shaft formation. Development 2008;135:1019-28.
    Pubmed CrossRef
  17. Stenn KS, and Paus R. Controls of hair follicle cycling. Physiological reviews 2001;81:449-94.
    Pubmed
  18. Cotsarelis G, and Millar SE. Towards a molecular understanding of hair loss and its treatment. Trends in molecular medicine 2001;7:293-301.
    CrossRef
  19. Hoffmann R. The potential role of cytokines and T cells in alopecia areata. The journal of investigative dermatology Symposium proceedings / the Society for Investigative Dermatology, Inc [and] European Society for Dermatological Research 1999;4:235-8.
    CrossRef
  20. Philpott MP, Sanders D, Westgate GE, and Kealey T. Human hair growth in vitro:a model for the study of hair follicle biology. J Dermatol Sci 1994;7:S55-72.
    CrossRef
  21. Carroll JM, Crompton T, Seery JP, and Watt FM. Transgenic mice expressing IFN-gamma in the epidermis have eczema, hair hypopigmentation, and hair loss. J Invest Dermatol 1997;108:412-22.
    Pubmed CrossRef
  22. Hirota R, Tajima S, Yoneda Y, Tamayama T, Watanabe M, and Ueda K et al. Alopecia of IFN-gamma knockout mouse as a model for disturbance of the hair cycle:a unique arrest of the hair cycle at the anagen phase accompanied by mitosis. Journal of interferon & cytokine research :the official journal of the International Society for Interferon and Cytokine Research 2002;22:935-45.
    Pubmed CrossRef
  23. Ito T, Ito N, Saathoff M, Bettermann A, Takigawa M, and Paus R. Interferon-gamma is a potent inducer of catagen-like changes in cultured human anagen hair follicles. The British journal of dermatology 2005;152:623-31.
    Pubmed CrossRef
  24. Enshell-Seijffers D, Lindon C, Kashiwagi M, and Morgan BA. beta-catenin activity in the dermal papilla regulates morphogenesis and regeneration of hair. Developmental cell 2010;18:633-42.
    Pubmed KoreaMed CrossRef


September 2017, 34 (3)
Full Text(PDF) Free


Cited By Articles
  • CrossRef (0)
Social Network Service
Services