Korean Journal of Acupuncture

Table. 1.

Table. 1.

Primer sequence for RT-PCR analysis

Gene Sequence Accession number Annealing Cycle
NFATc1 F: TGC TCC TCC TCC TGC TGC TC
R: CGT CTT CCA CCT CCA CGT CG
NM_198429.2 58℃ 32
c-Fos F: ATG GGC TCT CCT GTC AAC AC
R: GGC TGC CAA AAT AAA CTC CA
NM_010234.3 58℃ 40
TRAP F: ACT TCC CCA GCC CTT ACT ACC G
R: TCA GCA CAT AGC CCA CAC CG
NM_007388.3 58℃ 30
RANK F: AAA CCT TGG ACC AAC TGC AC
R: ACC ATC TTC TCC TCC CCA GT
NM_009399.3 53℃ 35
CTK F: AGG CGG CTA TAT GAC CAC TG
R: CCG AGC CAA GAG AGC ATA TC
NM_007802.4 58℃ 26
MMP-9 F: CGA CTT TTG TGG TCT TCC CC
R: TGA AGG TTT GGA ATC GAC CC
NM_013599.4 58℃ 30
CA2 F: CTC TCA GGA CAA TGC AGT GCT GA
R: ATC CAG GTC ACA CAT TCC AGC A
NM_001357334.1 58℃ 32
OSCAR F: CTG CTG GTA ACG GAT CAG CTC CCC AGA
R: CCA AGG AGC CAG AAC CTT CGA AAC T
NM_001290377.1 53℃ 35
Atp6v0d2 F: ATG GGGCCTTGCAAAAGAAATCTG
R: CGA CAG CGT CAA ACA AAG GCT TGT A
NM_175406.3 58℃ 30
DC-STAMP F: TGG AAG TTC ACT TGA AAC TAC GTG
R: CTC GGT TTC CCG TCA GCC TCT CTC
NM_001289506.1 63℃ 40
GAPDH F: ACT TTG TCA AGC TCA TTT CC
R: TGC AGC GAA CTT TAT TGA TG
NM_008084.3 58℃ 30

NFATc1 : Nuclear factor of activated T-cells cytoplasmic 1, TRAP : tartrate-resistant acid phosphatase, RANK : receptor activator of nuclear factor kappa B, CTK : cathepsin K, MMP-9 : matrix metallopeptidase-9, CA2 : carbonic anhydrase 2, OSCAR : osteoclast- associated receptor, Atp6v0d2 : ATPase H+ transporting lysosomal 38 kDa V0 subunit d2, DC-STAMP : dendritic cell–specific trans-membrane protein, GAPDH : glyceraldehyde-3-phosphate dehydrogenase.

Korean J Acupunct 2021;38:140-50 https://doi.org/10.14406/acu.2021.016
© 2021 Korean J Acupunct